Otolemur_garnettii Locus Mono:139:SNORA19
snOPY snoRNA Orthological Gene Database
Otolemur_garnettii Mono:139:SNORA19
Otolemur_garnettii
Mono:139:SNORA19
scaffold_14927
SNORA19
1001..1127
2127
AGTCAGCATAAATCCATTTTAAGCATGGCTCGGAGAGAAAAAAAATCCCCCACTGTGGC
TCCTTTATAAGCCTTAATCCTGGCTTCTGCATCTCAACGCAAGGCTCCTAGGGAAGGGAT
ATAGCACAGAAAAAGAGGCACCCACATCAGAGCTCAAGGTCTAGTCACACTTCTGCTGAC
ATTGTCTTACTCAAAACCAGTCATATGACTCCAAAGCAAATATAAGAAAATTTGGGAAAT
GTTTTCCTGTGTGCCCATAAAAAAGAAATCATGGCTCAGCACCTGTGGCTCACGTGGCTA
AGGCGCCAGCCACATACACCTAAGGTGGCAGGTTCGAATCCAGCCCGGGTTCGCCAAACA
ACAATGATGGCTGCCACCGAAAAAAAAAAAAATAGCCAGGTGTTGTGGCAGGCGCCTGTG
GTCCCAGCTACTTGGGAGGCGGAGGCAGGAGACTCGCTTTAGCCCAGGAGTTGGAGGTTG
CTGTGAGCTATGCCATGGCACTCTGCCCAGGGGGACAGCTTGAGGCTCTGTCTCAAAAAA
AAAAAAAAAAAAAAGAATCTTTGAGTTCCTTTAAGTTCAGGTTTTCTCATCCTTAGCACT
ATTGGTATTTTGGGCCAGATAAATCTTTGTTGTGGGAAGCTGTCATTTGCTTTGTACAAC
ATTTAGCGATATCCCTGGCCTCTACCCTCTACAGTCATGACATCTCTACACATTGCCAGG
TATCCTGGGGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNACAAAACCAC
CATGTACTTCACAGATAGAATCATCTCTGCTGCAAAACCCAGCATCCTCTGTCAGGTCAG
TCTCATGATATGTTAGAAGGTAGATTGACCTTCTCTTGACCAGTCCATTAGAAGTAGAAT
CAGAACTTTAAACAGCTTCCTTCATCATTATGTCAAGTACCATAACCAGATAGCTGAAAT
TTTATGAAGAAAATAAGAATTTAATTTCCTATGTGCTATACAAATAGTTGAAGGTTAATT
AGCAGTATGACTATAAATAATAATGTTGCCAGTCTCTTTTAGACAAGAAAAAAAAAAAGA
AAAGAATAATTTCAGTTGAAGATATATGAAAAGTCTTTATAGAAGAGGTTCTATTGAAAT
GATTATGGAAGGACAGGTAGGATTTATAGGAAGAGAGTCCTGGGGACAGCTGTATAAGCA
GAGTAGGGTGGAGTATATACAAGGGATAGAAAACAGCCCAGTAGGACTGGATCAGGAAGA
TCATCCTTCCTCAGTAAGAAAATCTCCTTGATTTAATTGACACAAAAATCTGATCACACA
ACTGATGGACATTAAGACAATTTAGTGTTTCCTGGATTGATATCTTTTTCTCCTTTTATT
TTTAATCTAGACCTATCTTTTGGTTCTGCATGATACCTAAAAACTCACATAATTTATTTA
ATGTTTAGTGGTTTCAAGATGCCTCTAAATATCCTCTCAATTTCCTATATGGTCATTAAC
GGTTAATTATTGATTATATACTTGAAAAAATAATCAGAAGTGTGCTCAATATAAAACTAT
TAAGTTGAAAAAAGAAATACCTATCTTGCATTTAGTTAGTTAGTTATCTGGTATTTACTT
TTCAAGGACTTGTTATGTTCCAGGTAAGATGCGTGTTAGACACAACTGATATAAATCCAC
TCTCATTCTTTCTATAAGTATAGGTGAATGCATTAGAACTAGAATGAACTAAAATGAACA
GAATTGCAACAATACCAGTATGCCTTATAACTACTTGTTCTTTTTTTCCTTTTTAAAATA
ATTCAAATATTAGACTAGCAGTAGAAAATAAAATGATGTGTGAAATTATACCGACATACC
AAGAATGGAATTTTATTTTGTCATGCTGGAAGCATTTAACCTAAGTAAATCAGAGGATCA
ACCTTTTCTCTCTTTGTGTGCATGTTATCCGAAGGAGACTCTGCAGGTATGACAGTGGAG
TCAGAAAAGAAGCAAACAAATCTCCCTAGGCAATGTGCCAACAGGATTTAAACTATTTCT
ATGAGACATGCTATATGTGATCTTATTG
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved