Otolemur_garnettii Locus Mono:507:SNORD83
snOPY snoRNA Orthological Gene Database
Otolemur_garnettii Mono:507:SNORD83
Otolemur_garnettii
Mono:507:SNORD83
GeneScaffold_437
SNORD83
1001..1076
2076
GGTTTCCTTTATGCTTTTTGTTACTGACTGCAGTAGAAACGGTAGACGATGTTTCAAAA
AAAAAATTTCAGACAGGCATTTTCTAAAGGCAAGCCCGGAGCTCCCGGCTCTATAGAACC
GCGGCAGGTCCTTTTTCCAGTCTCTTACGCATGCGCTCTGCAGCTGAGAAGGCGGGAGGC
TAGGGTAGAGGGAAGCCAGGAACCGGAAGTGAAGGCAGATTCCCTCCTTCGTCGTTGTTG
CTGCCGCCATACGCTCTCGCCCTGCTTAGGTAAGCTTTGGCCTTCACTACCATCCGTGTC
CATCTGCGCCTTTTTGTATTCATCCTGCTATAAGGGCTCATAATACCCCTTTCACAGACG
ATGTTCTGGTCGCTGGAGACTCGTTTGCTCGTTATTTCCATAGCTTGCACCCCTTTCGAA
AGCAAAGAGCTCGGGGGGGGGGGTGCGGAGGAAGGAAAGGTAGGAGGATCATATTCAAGA
TGGTGTCCTTGGCGCCATTGTGTTCCCTTTGCTCCCGGCTCCATTGGGTCCCTCGCGTAT
CGGAGGCCCCAGCGTCAACGAGAGGCGGCGCTAGGCGTTCTCTGATCCTGGGCATTTGCG
GAGGGCGGGGCTCTTCTCACCTCTCTTCTTTTGGTCCGTGGTGGGACCTGGAGGAGGAGC
CGGTTTCTGGGCCCAGTTGGGTTTTACTTATTCCCACCCGCCTAATCTCATTTGGACTGC
TTTCCGAATGTTTAGGAGCAGTGCTATTGTGCGTTTATCGAAAAGGAGTCTTTCCTGAAT
AGCACAACCCATGTAAACTAGCTGGTAAAGCTTCTGTTAAAGCTGGGACGGTATATGATC
TCTGTCTCAACTATTAGTTTCTTTTTCGTGGTAGGGTGGAGAAATTTTTTTTTTTTTTGA
CGGAGACATTTCTCTTACACTATTTTTTCTAGTATCGTTAATTACACAGGGATTTCTTAA
GCAATAAAAAGAGGGTACTGATGAGTGGGAGGTGGATGGCAGCCATATGATGTTTTTATT
GAGAAGTGAGCGCTTTGCGCAGTGATGACCTTAATCTATCACCCTTGACTGATGGCTGCT
GAGTTAGGGATCCACACTGTGGGATTATAGGGAAGTCTGAAGTCTTAGGGGAATTTTCAG
GATTCTTTTCATCTTCTCATCTTCATTTTCCTCTCCTTTAGGTCATTCGTTTTGTATGTA
TGTGTGTATACATAAACACACACACACACACACAGAGATATATACACATTTTTAAACTAT
TGTTTTTCTTTTCTATTGTTACTTAGATCAGGAGTTTGTAAGTTGTTTTTTCTCTTCCAC
TCGTGTTTTCTGCTACACTGAGGCTGACTTGGGGAACAAGCATCTTAAACCCTTTCCCTG
GGACCAATTTTCTATTTGTAAATTTGGCTTTTCACTTTTAGTTTAGTATCTCTTTGGTAC
TTTCGTTTTCTTTTCAANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved