Otolemur_garnettii Locus Mono:464:SNORA72
snOPY snoRNA Orthological Gene Database
Otolemur_garnettii Mono:464:SNORA72
Otolemur_garnettii
Mono:464:SNORA72
GeneScaffold_4851
SNORA72
1001..1115
2115
AAAAGGCCTTTGATGATCATGTTAATTTATAAGACCAACACTACCTTGTCTTCACCATC
ACCACCAGAGGCTTCCTGATAACGTTTTAGTTGCTTCATTGCTTTCAATACACTTATCAT
CTAATATAGGATATAATTTATTATTTACATTTATTGTGTATCTCAGCCTCTAGAATAGAA
GTTCCAGAAGTCATACATATATTTTTGTTGTTTTAGTTCCCAACTGCATCCCTATCACCA
AAATAATGCCTGACTCATAGTAAATGAGGTAGGTTCGATTCATTAATTTGTTAAATTAAT
AAATATATGTATGAATCAGTGACTGCATGAAGGAGTAAACAAAAATGAATGAAATAAATA
CCTATTTGGTTAAAAAAAACAAGCAAATAGCATTATTTCACAAATGACCAAAAGTCATTC
ATGTATTTTTTTCTTTAGTCTAGAAATAGTTTTTACTTAATGTAGACTAAACACAATTCT
CAGACCAATTTAATCAATGAAGTTCCCTCTTCATATATCTTTCTTAAAATTTTCCTTCTG
ATTTAAAAAAGGTAAGAATTGATTACATAAATCAAATAACTTCTCTAATTAACTAAATAT
GTAAAAATTTAAAAGTATAAGCTTTACCAACTAATGATGCAATAAAGTTATAATTTTTTT
AGTTAGGACTTCCAAACTGCCTATCATTGCTACTGAGAACCACTGAGAAACTACTTACAG
TTTTTCACCTACCCACATGATAGGTTGATTTTTTATTTTCAATCCCTAATCATGAATCAC
AAGAACATGGGAGAAGGGACCGGCTGCCAAAGGCAAACATTCAGTTTACTCCAAATTAAG
GAGCCATTTAAACTACTTTTCACTGTACTATGTCTCACAGTTATAGCACCATCTGGTGTT
TACGATGCATAAATGCTATGAGGATCAGTAGTACAAAAGTCCTTTGTCACTTAGTTTAAA
AAATGTTTAGGCACTTGAACAAATGATATAAACATATGTCTAAGTTGATAATGCCACAGA
TCCACAGGCTAAACATTCGCTATATAAAAACCATGCATGTGTCCCCCAGACCTAGTTCTT
TTCCTAGGTTTGGTTTTATAAATGCTGGTGATAAATGAAGTCTGATTTATTACATGATCA
GTTTGTGTGATTGTACAATGGCTGTGATTCTAGGTTATCTTTGGTCACAAGATATCTTTA
AGTGAATTGTAAAATTACTGTATTTTTATTTTCTAAAAAAAAAAAAAAAAAAAGATAATG
CCACAGATCCTATGTTCAATATGGAAATCTAGAACTAAAAATTGGGAAATCAATGTGGTA
TTATAAAAATAAACCATTTAAATAAATTTTGAATGAATACCCAAAGAATAAAAGGACAAA
GGAAAACTAGAAGTTATTAAAAGAGAAAACTGTGCTAGAATTTTTTAATAGACTATTTCA
AAATGCAAAAGTCAATGAAAAATAAATTATCAAATAAAACAAAGAGGTTATATTTGAATA
TCCAGGAGATCTAATTATAAAGCTTGCTTATAATGTAGTCTTAACCTTTATTTCTCTGGA
AGGTATTATAACAAGGCCTCAGTATATTAATAACTCACAGTTAATAAAATACCATACATT
TTGTTATACCAAGGAATGACTAATCTTATCTCACTCCGTATTTTCTAACAGGTAAATCTC
TTTACTGGCCAAGGTTTCTGCCCCAGCGTGCACCCTGACACCGTTACTTACACCAATACA
GGCTTTCCTGATATCCTAGGATGTCTTAGTACTTCTGACATTGTCTCTTTTGTCTCTTCC
ATTCTCTCTTCATCACTGGAATCCACAACAAATATCACTCCATAGGACTCTGCATAATAA
TTCTTCCAGATTCCCCGAATTCTTTTTCCTCCTCCCAAATCAAAGATAGTAACTTCAAAC
TTTCCTTGTCTAAGGTCAATTTTGGAAAATCCAACAGTAGGAGCTACATCTTCAGGGCAC
TCTGTTTCAAAGGATACAAAAGAAACGATCTTTAGACTTTAAATTAATAACATTAGTTTA
ACTTTATAACATTAATGACACAAAAAGTGTTATTAGTCTTACTTTAGCACTGAGTGAGAT
GCTTCTTATTTGCTTA
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved