Otolemur_garnettii Locus Mono:437:SNORA73
snOPY snoRNA Orthological Gene Database
Otolemur_garnettii Mono:437:SNORA73
Otolemur_garnettii
Mono:437:SNORA73
GeneScaffold_2922
SNORA73
1001..1204
2204
AAAAAGAGAATGACTTTCTTAAGAGATGAGAGATTTTTAGTTAATTCCCTGGATTAGTT
ACTTTTAAACAGTTTACAAAAAAAAAATCTACATCTGTTAATTTACTGCAAGAGCCTTTG
TAATTTGAGAGTTCCAGGGCAGGGGAGGATGGGTACAGATTTGTGCAAAGAGTTAAATCT
CACGATGTGAGCATGCTTGGAGAAGTTCCACCTGTGTGTACAATGTGCTTAAAGGATTAG
AGCAAACTTTGAAATTATGATATGTTTTATCTACAGTAAGCACCTTACTTTTTAAGCTTC
TATTTCCTTGAAGGAGGGAGGAGAAGGCCATCAATTCTTTCAGAAATCAGGTGCATGAAA
CACTCTGCTTGTGGGATTTAATGAAGGCTTAAGTGCAGGGGGATGAGGATGTGTTGTTTA
TATATTTAACATATTAATAAAATCTATTTTCCACACTTGTGATTCCAATTCAGAGATGTC
ATTTGCAAAATCTGTTGCTCTGGATGAAGGTAACATTTTGAGGGAGATGCAGGAGCCAGA
GGGTGGGGGGAAGTTGTAGCCCAAGGGGCTAGTGGGACAGGAAAGGGAATTTTTAAAGAA
GTATTGCTGTGGTCCCCGTATTCCCTTCAAGAAATATAAACAAAGCCAGGCGTGCTGGCT
CACGCCTGTAATCCCAGCACTTTGGGAGACTAAGGCAGGAGGATGGCTTGAGGCCAGGAG
TTTGAGCCTAGCTTGAGCAACATAGTGAGACTCCTTCTCTACCCCTAAATAAAGAAAAAT
AAATAAATAAATAAAATTAGCCAGGCATGTAGTCCCAGCTGCCCGGGAGGCTGAGGTGGG
AGGATTACTTGAGTTTGAGGTTCCTGGGAGCTGTGGTATCACCACTGCATTCCAGTCTGG
GTGACAGAGCAAGATGGTCTCAAGAAAGAAAGAAAAGAAAACATATCCCTGGGGTGGAGC
AGGCGATGGTTAAACTGGAGACACAAGAAAAGTCTTTTCCTACAACGTGGATACACCCTG
GAGGTCACTCTCCCTGGGCTCTGTCCAGGTGGCATAGGGGAGCATAGGACTTTGCCCCAT
GATGTACAGTCCCTTACTACGACGTTGGAGATGAAGCTGGGCCTGAGTCTGCACCTGCAT
ATTCCTACGACTTTCCAGAGTCTTGTAGACAATGACTGGGGAGACCAACCATACAGGAAA
CAGCCTTTTAGAGCACCCAAGCTTAATCTTAACTCATCTTCAGTTTATTAATTGATTGTT
AATAATCAATTAATTGATTGATTAATTAATTGATCAAATTGATTATTAATTTATATATAT
ATATATAAAAGAAAAGTCTTTTCCCCTCTCCATGTTTTACCGGGAATGGAGGACACAGTC
ATTGGCTGCTGGCAAAGCTGCAGCTGTTGGTTTTCTGGTCACCATAGGTTTTTCAGATGG
ATTGAGGGGGAGGGACGTGGTAGCCAGAAATAGGTAAGCGTAAATAGCTACAGTTTTTAG
GAAGCTGAACATCACACACAGATAGGCCTAATAAAGACATAGATACTTTATTTTAAAAAC
ACCCATATGTTGCAAAAATACATAGAAAAATAAAGTTTGGTGGGGGTACTTTTCCAAACT
TCAAGTCACAGACTTCTTGTGTTACAGATCCAAGCAGGGTTTGTTATACGTGGAGAGCCC
ACACTAATTTATTAAACAGGGGAGAAACAGGGTGTCTGGGTGAAATGGTTCAGAGCACTG
CCCAGTTCACCTGGCAGATGCTAATTCTCCAAATGTTTCTTGATACGGGTTCAGATAGAG
GCTGATGACTGTTCCAATGGGAAAAAAGCATATGGATTCACAGCCAAACAATTTTTAAAA
ATACCTCTTTTTTTTTTTTTTTGCAACGCAGTCTATATCACAGTGAAATGTTTAATCCTT
GCAGAATTGCAGGTTGAAGGAATTAAATTCAGAGGTGGAGAGAGAAAAAGTACTGAGTAG
AGATTGAACACTAAACACTAATTTTCAAAGAGGTGTGGAAAAGAAGAAAGCAAATTAGAA
CGCTCTGCCTTTTGTGGTCCTGTGGTGGGTGTCAGCAGCACAGCACGTGGTATTTAACAA
TATTTCACTGTGGAGCCCAAATCTTAGAAAAATGGGGTGAAAATGGCCAATTTTGTATCT
ATTTACTTTGGCTGTTTTGCCACCCCAATAGTAAATTGACTCTTT
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved