Otolemur_garnettii Locus Mono:31:SNORA11
snOPY snoRNA Orthological Gene Database
Otolemur_garnettii Mono:31:SNORA11
Otolemur_garnettii
Mono:31:SNORA11
scaffold_91179
SNORA11
1001..1135
1431
GATTCTTGTGCAGGCTGAAGTTTAGATAAATTCCCTGGGTGATTTTCCAGAATATTCGT
GTGCCCCCAACGTCTTTGTGATGATTTTTGCCAACCCCAATTAACCCACCCAGGTTGAGA
TTTCCTTAGTTTTTCCAATATAGAAACATCAACATTATCAATATCCAGTTTACCTACAAC
GGTCTTTCTCTTAGTCTATGTATGATTTTTTGGAGATGGCCTTGTGCCTGAGCAGATTAT
CAGGTTGGAATAATTTTTCAGAGAACAAATTACCAGTGATAAAGTTTCTGAGCCAGGAGA
GAGAGGGAGAAATAGGGTTGCTTGAAAATAATTCCTTATCCTCTGTTTATAACATGCCCA
ACAGGAAACTGGGATCATTGTGATGAGGGGCACAGAACTTGTGGCCTCTCTATCAACAAA
TTCCCTACATGTAAAGAAGAAAAAAACGATAAAATGTATGTGGCGGATGTATGGGTGATG
ACTGTATAATTCTTTCAACTGTACTGTATGTTTTTAAAATTGCCTAATACATCCTTCTTA
GTAAAGCATCACAAGAATGGAAAAAAAAAAAAAAAAAAGAAAATAATTCCTTAATGCAAG
AATGAAGTGGCAACTGGGGAAGCCATGAAGCAATAACTCCAGTTTCCTGTGCACTGGTTA
TTCTTTTATATATAAATTTTATCTTGCTGGCTCAGCACTTATAGCTCAAGTGGCTAAGGT
GCCAGCTACATACACCAGAGCTTGCAGGTTCGAATCCAGCCCGGGCCTCCCAAACAACAA
TGACAAGTACAACCAAAAAATAGCCGGGAGTTGTGGCAGGTGCCTGTAGTCCCAGCTACT
TGGGAGGCTGAGGCAAGAGACTCACTTAAGCCTCCCAAGGTTGCTGTGGAGTTGGAGGTT
GCTGTGAGCTGTGACGCCACAGCACTCTACCCAAGGCAACAGCTTGAGGCTCTGTCTCAA
AAAAAAAAATTATCTCGCTGTGGCCATGGATTCTGATTATCAAAAATGATTCTGTGCCTG
CATTTCTGTGGCAGAAACCAGTGATTTGGCCATTTGTGGCAGCAGATTGCAAATCTTCTT
GGCTATTGAGAGTTGAAATCCTTCTTGGCTATTGAGAGAGTTGAAATCCTTCTTGGCTAT
TGAGAGTTGAAATATCCCAATATTCAGACACCGAGTCATGAGTAAAAGAATAAAAACAGA
GAAGCCACATGGTTTGGGTTAAATTGGAACAAGTAAGGAAATGTCCCTCAACTCCACAGG
CAACGGCTACAATGAAGGAGAGAGAATGTAGAAATGCCGTTAGCTGGCTGGAGGGCCTGT
GTGTGAGGAAGCCGCGTCTCAGAAAGCTCTGGGAGCTGCCTAGGTGACTTTTACTGAATA
TTATAAACATAAATGAAAAGCATGTGAATAGTCATTTTAAGTCTTCCAGCCC
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved