Otolemur_garnettii Locus Mono:140:SNORD47
snOPY snoRNA Orthological Gene Database
Otolemur_garnettii Mono:140:SNORD47
Otolemur_garnettii
Mono:140:SNORD47
scaffold_15291
SNORD47
1001..1078
2078
ACAGTAACTGGCTACAGAGAAGAGCTGCCCAATGGCTATTTGGACAGGGAATATTATGA
GTGATATGGAATTTTTTCTCCGTTTCCCCTAGGAATCTTCAATAAATTCCACATTTCTTA
CTAAAGAAATAAATGACAAATTAGTGTCACGTAGAGCACTTGATAACAAATATCCTTGAA
AGTAATTTTCCCCTCCCTCGTGCTGCCATTTTCCTTTCTAAAGTTACCTACTGATAAAAA
GCCACATTGTGGTAGACAAGGTTCTCTTATCCCTCCTCGCTTTGGGTTCAGGGTAGAAGA
TGTGAATGTTTATCAGCCACGAAAGCTGTAATGATTTATCCTTTAATTATTGTGCCCAAG
AATGTAGATAAAGTATTAAAAGTAAAGAACACAAAGCTGACCAGAAATGACCCTGAAATG
TCACTAAATAAAATCAATTAGGAAAGAAAGAAAAGCTGAGGATGCTCTGGTTGATCTCCC
TGTTAAAATTTTGTCTTGTTCATTTAATCATCTGTTCTATCAAAGGATACCTCTCTGAAT
GGTACGTAAAGGCAATACACACTTTTTTTTAGAGACAGAGTCTCCCAAAAAAAAAAAAAA
AAAAAAAAATCACATCACAGCTCACAGCAACCCCAGCTCCTAACAAATGCAATCTCGACC
TCGACCTCCGAGTAGCTAGACTATAGCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNTATAGCTGCCTGGGACTACAGGTGCCTGCCACAATGCCCAGCTATTTTTGGTT
GCAGTTTGACTGGGCCGGGTTTGAACCCACCAGCCTTGCTATATGGGGCTGGTGCCCTAC
TCACTGAGCCACAGGCACCACCCAAAATATACACCCTTGATGGCCACACTCAAGAAGAAA
AACCGGGGCGGGGAGGGGAATAAAAAAAAGAAGAAAAACCAAACCAATGATATAATGATT
CTGCTAAATGAAATGGAATGGTATCACTTGTAGAACCAGTCCATTTTGGTTCTAAGGTTA
GCTTACTGTAAAAAAAAAAAAAAAAAGAGAGAGAGAGAGAGAGGAAGCAGAAAGAGAAAG
GGGGGGAGGGAGGAGGAGGAGAAGGAGAAACAAAAACCTGTTTATGTGAAAGCTTTTGAA
TGAAGGTAGGAAGAGGCTAGTGAGAACTGTGGGAGAGGCTGGCCCCTTTCTAGGAAAATG
AGAAGCAGGAAGGCTTCTGTAAAAGCATACACTGAAGCCGGGTCTTGAAGCACAAACACG
AATTTGCCAGAAAGAAAAATGAGTTTAAGTCCCAGTTAATAATATGTGCAAAGTCCCAAG
AAGGTAAAAGGCCATGGTGTATTAGGAAGTCAGATAGGACTCTTCGTACCGCAGATTAGG
CCAGGGAGATAAGAGGGAACTGGTGGTTAAGGATTTTATTTACTACACTAGAAAATTTGG
ACTTTACCCTGAAGGCAACTGAGAGCTGATAAAGATGCTAGAAGACAATGAAGCATGTTC
CCCGTGGGAATGTTAGAAATCACAGCCGTATACACATAAAAACGTAACTAAGAAATGGCG
GAGGGAGAGAGCTGAACACGGAGACATGTACTAACTTACTCCGTTTTCAAAGCAAGGAAT
CAATAGGTATAAAAGTCAGTTAGAAAACAGAGGCCATCTATATCATCCAAAGTCAGAAAA
GGCAACCACTAGAAGAACTGAATATACTCGAGGTAACGAACACAGGAGGCGAAAGGCAGT
CATTTAGGTAGAATTTGATGTGAGAATGCTTCTCATTCTTTACGGCAAAGAGTCAGATGG
TATTGCCCAGAGTTAAATCGGGTAAGAAATTAGCAAGAGCACGTAAAATTGTCGCTCTAC
AAAAGGAGATGTGGTTCCCTAAGGAAGGAGATATTTATTGACTAGCTTTTACTCTGTTTG
ATATTTGTTTTTTCTTCTATACTCTTTTTAAACTTATTTATGTTTGAGAGAGATGGTATG
GAGAAGGAAACAAGAGGAGAGAGAGAAAAAGAGAGGGAG
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved