Otolemur_garnettii Locus Mono:281:SNORD43
snOPY snoRNA Orthological Gene Database
Otolemur_garnettii Mono:281:SNORD43
Otolemur_garnettii
Mono:281:SNORD43
GeneScaffold_3228
SNORD43
1001..1062
2062
CAACATAAAACCTGAGCATTTATAGGATGAAACACCCGGTGACTCGAGTGTACCTTGGC
AGTCTCATTAGGCAGGCAGGAGACAGTGCAGAGGAGGCAGGAGGCGACTAAGAGAGCAGC
AAGGTCTGGGCAACTGTGGCCATACTATTTAGCCATAAAAACAAGGAGACTTTATATTGT
TTGTATTTACCTAGATGGAGTTAAAGCACATTCTTCTTAGTAAAGTATAACAAGAATGGA
AAAGGAACTATCCCATGTACTCAATACTAATGTGAAACCAATAGTAAAACAACTACCCAC
CCGCAGGAGAGAAAAACATGACTGTATTCAAGTGATGTGAAGAGGGGCGGGTAGGGAGCA
GGACTGGTAAGTTCTCACCTAATAGACACCATGTAAGAGTATGCAGCACACTCCCTGGAT
GGGGTGGGCGTGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNACTTCTTTTATTC
ATAAAAGAGTATTTGTGAATATGTTTCCTAAACAATGACTATATGGGCAATATATTTGTA
ATAAGTTCACAATTGTCTTATGTTGTCAACATTTTGTACATTGAAATGGCCAAATTTAAA
ACACTCAGAAATCAAAAATTCATAAAATAAAATAATCTTCTATCTCCCCCAAACACACAC
ACTGATTTGTCAACTAAATCTGTTTAATGTGCTATTTTTCCACAGCAGTATATGAACATG
ATCCTTAGTCAATAAACGTATTTCTACAGGATCATTTTGTGACTAGGGCCACAGATTTTC
TTGATTTACAAGTTATTTCACTCACTATGTCACGTTACTAGTTTAATCTTTTCATTTTCT
AAGATGTATCAAACATAACCAAGATGTGTATTAGAAATTCAAACAGGTGATGAACTCATT
GATGGGTGGACAGAGGCTGTGCTGATTGTCATGTTCTGATGTGGTTCTGTGGTGTTCCAG
TGGCCTGCGTGTATCAGTCTGTACCCATTACCTACCGCTGGACCATTTGTTCCCTAGTTG
TTGGGAGGTCAGACTCTATAAACCAAATTGTTATGTTAACAGTATTACTTAAGTGTGCTT
TTGTCTGCGGTTAGAGAAAAACAGTGAACATTGTTCCTAAAAACTGAGACAAGTTGGAGT
CAACCTTCAACTTTCATTTTGTTGAATTTTAGTGTATTCTGGATTTGGGGATTCCTGGGA
AAAGGTGAACTTAGCCTATAATCACATTAACCTGGTTTTAGGCCCAGTCAAAAGTCAGCA
TTGCTGAGAATGCTTAGAACAGCAGTTTTCAACCTGTGGGTTGTGACCAATGAAACATTA
CGATTCATAACAGTAGCAAAATTACAGTTATGAAGTAGCAACAAAAGTAATTTTATGGTT
GGGGGTCACCACAACATGAGGAACTATATCAAAGGGTTGTGGCATTAGGAAGGTTGAGAA
CCACTGGCTTAGAACGTAACCAGCTGAGAACTAAACTGGAGGCTGTTTTGTTTTGGGTGT
TAATATTGGCATGTTTTTAAAAAATAAAAATAAAAATAAAATACAAATTCAAAATCTGCC
TTTCTATATGTCCCCCATTTTCTCCTTTTCTATTATGTAAGAATAGTCTCTCTTAATTTC
TTTGCATCTATTGTCCAGATATTTTTTCTGCATGTGATACCCTAACTTATTTTAGTAACA
CACATACCTGTAAACCAATGTTGAGGTTTGTAATAGATATAGATACATATTATATAATAT
ATATATATATATATATATATATTCCTCTACATAATGGAATCATATACTTACAGCATTGTC
ATGTATGACTTTCTTGATTGAGTATATATCATGGCTTTTAATTTAATTTTTCATTTGTTT
TATATTTTTTCTAATGTTTTGGGGTAATTTATATTGGTTTCTATGTGTATTATATCTTTG
TATCATTGATCTATCTCTGTTAT
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved