Otolemur_garnettii Locus Mono:147:SNORA1
snOPY snoRNA Orthological Gene Database
Otolemur_garnettii Mono:147:SNORA1
Otolemur_garnettii
Mono:147:SNORA1
scaffold_115562
SNORA1
1001..1129
2129
CTATTAAAGCCAAGAGTGAGTCAACCAAATTCCTCCATAGGACCAAACTGAACAGAAGG
GAATTGTTCCATCTGTTGTCAAAACTGTCCTCACTGAGTTCAAAGAATTGCAGCTCAGGA
GGGAGGGATCCCCTGGGGGCTGCGTGGGGTGGAGGGAGGTGGAAATGGAGCTCCTGGGCT
TCCTATCCCTTGGAGTGGAGTCTCAGGGCTGGAGCTGCACACCACCACCGACTGTCATCC
AGTTGACTTCTCTTTGAGTCTGAGGCTCTGAGGCTCTTCACAACCCCCATCCTTCCCCTT
AGCCCAAACATACCCAATGCACAACTTCTGTTTGAAGTGCTGCTCTTCCCAGGGCGCCTC
CGAGGTGCCACGGGATTAGAAGAAGCCGCTTGGGCTCTGGGAGGGGTAAGGAGACCTAAG
CCCCAGCCAGCTGTGGGCTTTTCAGCCTCTCACCGGGTGATAATGGAATTCTGGGCTTTA
CCACAGAGATCATTGGGCCCCAGAGGGTCTTAATTAAAATGGTCATGTGAGCCTTGCAGG
CAAACACCCAACACTCAATGTGGGAGCTTATTTTGAGTTCTGGTTCAGTTTCTGCCAGAG
AGGCTGGGTTCACAGGAGCTAAGGAAGTGGAAGAACTGGACCAACTATCTATATCCTAAA
GTGAAAGACTCTGCTTGCAAGTTAATAATCCAGAGTGCTCCCAGCAGACACCACTTCATC
CATCATCTCCCTGTGCTAGCGCAGACATCGTTAGAAGCCATGCTGGAAATCGCTCATAGC
ACGTGGGCAGGATTGATGCTTTCTCCTTCTCCTCTGGGGTTATTCTAAGCAAAGGGTAAT
ATATAGATAATTTAATCAATTATTTCTTTTAAAGCTATTTACATGTACTAGTTACTACCT
TTCAGTGGGAGATATTTATAACACTGAATTGTCTTGCTATAGAGCAAGAATCTTTATATA
GAAATGTCAAATTTAGCTTTAAGCAGAGTTAATATTAAAAAAAATATATATGAGATGGGC
ACTGTTGATTTTGGTGTCCAAAAATTGTTTATGTGGCTAAACTGAGACACAGGTTATGCT
TCTAACACAGTTTATGTATTGCAGTGGTGACAATGAGGCCTGGAATATTTTGCTAAGAAA
AAACATGAGATAATATAAAGTAAAATGTAAGATACTCTTCCCTTAAGAAAAACTTAAGAA
TTATAAAGGTTAGTCACAGATTTTTGTGATTTCATTTGAGCAATGACTTTAGACACAATC
ATTTGAATATATCTGCTTTTAAAATATTATTTTGCAAATTGTAGTAGTTAAACAATCCAG
AAACACAGACAAGTAATTACTTAATTAGTGCCAGTTTACCTTCTAGACTATAAGCTCCAT
GAAGGTGAAGGCTATGTCCACTTTGTGCACCGTAATATCCCTAGTTCCTGGTATGATTAG
GTACTCAATAAATATTTATGTGTCCATAGCCACACCACTCTGAACATGACTCTTTTGATC
TCGTGAAGGTTAGCAGGTCAAACCTGGTTAGTACTTGGATGAGAGATCACCTGGGAACAC
CAGGTTAAAACACATCTGTGGATGAATATTCAGAGAGGTGCAATATACTGATGTTGGTGT
ATATTTGCTTTCATCTTATAAGAATGCCTGCTTTTTAAAAATAATTTTCCCCTTATTAAA
GATGAAGTTATAAATTTAGACTTTATTATTTTAAGTAATCACTAGTGGGTTTCTATAAAG
AAATGTGAATAAAAATATCCTGTGATTATCAAATAAGGTATGCAGTGGTTTGTCATTTTG
TGAGATTGACAACATTAAACAATTGGGGAAATGGACCTAGTAAAGCAGAGTGAAGACAAA
CTGCACCCAACACAATTGTTTAAAGAAGCCACTTGTAGCTAATGGTGCCTGGGGATGACT
TAATCTTAACTGTTTCATGGTAGTAGGACCAGGGTATGTAGTTGAGGGCACATGTACACT
TGGTATGCTGCACTTTCTGTCTGTGAAGATGACCAATGGAAATGGCAGAGCTAAGGGACT
AAAGTCTGAGGTTGGGGGGAGGACAACGCACTCCTAGACACCGGAGAGTGTGGACCCCAG
GGCTCTGTATGAGGAAGCCTCATCTTCCTG
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved