Otolemur_garnettii Locus Mono:9:SNORA23
snOPY snoRNA Orthological Gene Database
Otolemur_garnettii Mono:9:SNORA23
Otolemur_garnettii
Mono:9:SNORA23
scaffold_87217
SNORA23
1001..1180
2180
TACATTCTGAGAGCTACTTGCAGGTGAGCTAGAATAAAACCCCTAAATCCTAATTGACA
GAAGCCAAGACCCTCCATACCACATAACTTTCAAATCAAAATAAGTAGAGAACTGATAGA
TGCTCAAAGAAAAGCTATTACTCTCTTCTTAAAGCCAGAAAGTGATATACCATGGGACAG
ACTTGTAATGACTGGAGCTGACTATCAGATGAAGGTGTGGGAACTGTATTTCCTTGCGTT
AATGTCTGCTTGGCCAGTAAATGGGCTGACAGCAGGGGGATAGCAGTGGAGCACTCTGCA
CACCCAGTGTCTGGTGAAATGAGGCTGCCTGTGTCTCTCTTGGTTCAGTGGACATATTAG
AAAGTTGCTGGGCATAGGCCCATTGTGCTGGTATAAAAAAGAACTGCCCACTGAATGAGA
GCACCCCAGTAGCATGAGGTCCTGAATTGAAAGTGGAACTGTGCAGTACATTTCAGAAAA
ATGCCCAGCATTTGGACACTAGACCAACGGCTGGATACCCCAGCCAGCCATTGCACCCGT
AAAATCAGCCATAACTAACGGGTGGAGCATTGCAACTATCCCTGGCCTGGAAGGAAACAT
GTGCCTTTTCCTCCTCCACTTCCTCACCTAGTGCCTGAGAAGAAGCTGAGGAAAGGGGAA
AAGGAGGTCTGTGTGTCTTATCCCAAGCTAGTCTTGTGCACCTCCTACCTGCAAGCTTAT
AATTAAGGTCCTACCTAACTTATTCTGGATGAGTAGCAAAGAAGAGATTTGGAGCAGCTA
AAAAGCTGTTAAAATTTGGGCCAACATATTTTTAAGAGAGCTTTACGAAATATGACAGCT
GATTCAGTGTAGTATAGATTAGAAAAATGGTTAGAACTAAAACCATATTTGTTTATCGAG
TTTAGATTTTTTAATAATTAGAATATTTTTGTGGGGAAAACTGGCATACATGAAAGAATG
TAGATAGCCTTTGGTGTATTTAAGTTCAAGTTCCCGTGGCTGTTGTAACGTCTGCATAGT
TCTCATCTATGGCTGGTAGCAGTGTCTGTGTTTTGCGCGAAGATCTTGCTATCCACACAA
ACGTCATGCAGCCCAAGAGAAGCTTGGGATCTTAGGACTGGTCTAGTGTTGTCTCTTAAG
ACGTATCTACCACTGGCCAGCCTCCAGATTCCCTCACACAGAACGTTGGGAATAGAGATG
AATTGGGGGGAATTTAGTGCATGTATCTATAGTAACTCATTGTAAATAATTTTCAAAAAC
TCAAGTTCCATCGTATATCTGCAGCTCTCTGGGTTCTTATTGGTAGAAGTGAATTAATAG
TAACACTTCCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNTGTACGGGGTATGTGCATATGATATATATAGCATATA
TATAACTGTGTGTATATACCACATACACATCGTGTATACACATACATTACCTACCAGGCT
CATTGCATTCATAATAGATAAAACATATTACACAAGTGACAAATTTTTAAACATCATTTG
AATAGTAGAATAAAGATAAGCAAAGAAAATCTCCTGGACATTATTTATGATTGTCAGCTT
GAGAGCCTATAATTTCAACTCATTGGGAGACTCAGGTAATTTTAAACATGCTGTGCTGAG
GGCTAATGATTGCAGAGGATGTGGTGTGCTGATGCTCGGGTCTACCTAGAGAACATAGCT
ACCAAGGAGAGAATGGGATTAGGCTGTCCAAAGCAATGTAATAAGGAGTAATGGAGTAAA
ATTAAATCAGGACAATTTCAGCTGACTAGAGAGAAAAAAATGTCCTATGAGATCTTATTA
TCTTCTGACACATTCTCACATGGGAAATTGTGAAAATGCTAGGACTTGCATAACTTAAAA
TTGTCCTGACCACCTAGCAAAGATTTTTAATTGTAAGAACCTGTCCTAAAACTGGTTTTC
AAAGGCCTACTTAGGAATAAG
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved