Otolemur_garnettii Locus Mono:441:SNORA70
snOPY snoRNA Orthological Gene Database
Otolemur_garnettii Mono:441:SNORA70
Otolemur_garnettii
Mono:441:SNORA70
GeneScaffold_1941
SNORA70
1001..1135
2135
GAGGTTGCTGTGAGCTATGATGATGCCAGAGTGAGACTCTGTCTCAAAAAAAAAAAATT
ACCAGTTAGTTCTTTGAAGATCAAGCTCATCTCCAACCTCACAGTAACAATAATAAACTT
ACTATACATAGTATGTGATAAAAACTGTTCCAGAACTTTTTATGAATAAACCAATTAAAA
CCTCCTGACAACCCCACGAGGTGGGCACCATTATTATCATCATCCCCACTCTGCAGATTA
GGGAACACGGAGAGCACTGTGGCTAGCGTGGCACAGAGGCAGTGCGCCTTCAGAACTCAA
CTCTCAGCCCTGTACAACCTGCTCCTCGCAATACCCCCTCCCCGAGGTTGCCAGGAGGAT
AAAATTAGACAATAAATGGTTAGTGTGATATGTATTTCATACTCTTACCTACTAAGTATG
GCAGGTGAAAGTGTTTTATATGCTATAAAAGCAGTGTACAAGTATTAAAAGTATTTTTCT
CTTCCTGAAGAAGACAATAAATATTCCCAAGCATTATAGATTTACCCAAACTTAAAGAAG
AATGGTACTAAAATCTTAAAATGAATGAATAATATAAAAATTATATCAATAGCTCCTGGA
CTTCAGTATGCTCTAATTCAGCAATTCACTCCATGTGGGGGAGAAACCAAGAACATGAGG
CAAGCAACACAGATATTAAAAAATAAGGATGGGTGTGATAGCTCAAGCCTTTAATTCCAG
CACGTTAGGAGGCCAAGAAGAGAGGATCATTTGAGGCCAGGAGTTTGAGATCAGCCTGGG
CAACATTGTAAGACCCCATCTCCACAAAAAAATAAGCAAAATTAGGCATGATGGTGATGG
TGGTGCATGCCTGCAGTCTTAGCTACTTGGACAGCTGGAGTGGGAGGATTATTTGAAACA
GAAGTTTGAGGCTGTATGAGCTGTGATTGCACCATTGCACTTCAGCTAGAGCCACAGAAT
GAGACCCTGTCCCCCCAAAATTAACTAATTGAAAAAAGATCCTGTCGCCAATGAAGCTGA
TGGCATTCCTTTCCTCTTGGGAGCCCAGTGTGTAAACATCATAAACAACAGCCTCCTTGG
CAGTGTACATAGCTGGTTGCTTGCAAGGGTTGCTCTAGGGAACCTTGGAGACAGCCCTTT
GGATGTGGGTGTGTCAGATCTGGTGCTGCGTCAAATTTAAGCTCCAGACAGGAGTGCAAG
GTGCCTTTGGAAGTCCCCAGGGCACAGTGGCCAGGGTTCCCATCGGCCGTCATCATGTCC
ATCCACACCAAGCTGCAGAACAAGGACCATGTGGCTGAGGCCTTAAGGCCGCCATCAGGT
TTCCTGGCTGACAGAATATCCCCATTTCAAAGAAGCCGGGCCTCACCTAGTTTAATGCGG
ATGAATGAAGATACGGTGGCTGAGAATGGCTCATCCCAGATGGAGGTGGGTGGAAATACT
CCCAGTCACTGCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGGAAATATGGACCTTCTCTGCT
CTCACTGAAGTATGAATTTCTTTCATTTACATCTACCTACCTGTCTGTATCTGTTTATCT
ATCTATCCACACATTCATCCACCCATACATCCACTCAATCATCTGTGCATTCATCTAATC
AATATTTATAGAATGCCTATCATGTGCCAGATGCCATTTTAGGTACTAAAAACCTACTTT
TTTTTTTTTTTTTTTCATTTAAAGACAGTCTCACTCTGTCACCCAGGGTACAGTGCTGTG
GCATAGACCAGCTCAACCTTAAACTCCTGGGCTCATGGTATCCTCCCAGCCCTGTCTCCT
GAGTAGGGGGGACTATAGGAACCTGCCATGACACCT
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved