Otolemur_garnettii Locus Mono:347:SNORD58
snOPY snoRNA Orthological Gene Database
Otolemur_garnettii Mono:347:SNORD58
Otolemur_garnettii
Mono:347:SNORD58
GeneScaffold_4514
SNORD58
1001..1064
2064
CGGCCGTTGTGGCGGGCGCCTGTGGTTCCAGCTACTTGGAAGGCAGAGGCAGAAGACTC
GGCTGAGTCCAGAGTTGGAGGGTTGCTGTGAGCTGAGATGCCCCAGCACTCTACCAAGGG
GACAGCTTAAGGCTCCTGTCTCAAAAAAAAAAAAAAAGATTGCCTTGGCAAGGGTTAATG
TGGTTTGTTGGCTATTTTCCTGGTGGAGTAATACTGCATTTTTGATAGAAGTTAAAACCG
TGATGATAATGCAAAGTCCCACACCTGGAATCCTAGCATTCTGGGAGGCTGAGGCAAGTG
GATTGCCTGAGCTCACAGTTTGAAGACAAGTCTGAGCAAGAGCAAGACCCCACCTCTAAA
AAATTTGTTTTCCAAAACTTGTTTTATCATCAAGTTTGAAATTTGAGTAACCACTTTTTA
AACCCTTTGGAAATAAAAATGCCTGTGGGCAGGGCCAGCAACTGGCTTACAGGCATTGTT
CACAGTCAAAAGGTTAATGACCTTTAGGAAGGCTGCTCATAAACAACATGCATTCAGGAG
GAGTTTACATTCACCAGACTTATTTTGGTGGAGCCCTAAGACACTAAACCCTGAAAGTGA
GACAACTGCTTGAGCAGATAAATCCAAAGTCTTAAGGATTGCCTTCCAAAAATGACTCTC
ATAGGCGAGTTTAGAAATGAGTGTTTACTAATGATAGTTCTTGGTGTTAAGGTAACTAAA
GGTGTTACTTGATTTGTTCTCTGTCCCCGCTTCCTAGGGTTTAGATGTAGATTCTCTGGT
CATTGAGCATATCCAAGTGAACAAAGCACCCAAGATGCGTCGCCGAACTTACAGAGCCCA
TGGTCGCATTAACCCATACATGAGCTCCCCCTGCCACATTGAGATGATCCTTACTGAAAA
GGAACAGATTGTTCCCAAACCAGAAGAAGAGGTAGCACAGAAGAAAAAAGTAAGTTGCTG
CTTGGTTTTGTTTGTGTGTGGTGTTGGAGAAAGATTTGTGGTTGCTATGATGACTATCTT
AGGACACCTTTGGATTAACCGTGAAAGGAAACTATTCTGAGCAACCTGACCCACCCAGAT
ATACATAGCCATTTCAAACATGTCCTTTAAAGGGGCCTTTTTCCCCTTCCCCCCAAATTT
GATAAGCTTGTTTTCAGTAAATGATCACTTTGAGTGATTCTGTACTCTTCCCTTCTTACC
AAATGAGTTTTTTTATATTTGTTTTTCCCCAGATATCCCAGAAGAAACTGAAGAAACAAA
AACTTATGGCACGGGAGTAAATGCAACATAAAATAAATGCAAATAACTGTCAAAGGATAT
TGGTTGTCTTTATTAGCAAATCTGTATCAAGTAACTTCGCAAGGTGGATCAAATGGCTTT
TCTTAGAATTAGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNN
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved