Otolemur_garnettii Locus Mono:179:SNORA32
snOPY snoRNA Orthological Gene Database
Otolemur_garnettii Mono:179:SNORA32
Otolemur_garnettii
Mono:179:SNORA32
scaffold_50994
SNORA32
1001..1120
1193
GAAACTGCCTCAAGATCTGCAGGAAAGAATATCTCTTTTGAAGACTCCCCAGAGAGATT
AGAAAACTCATCTATGGTCATTACCAAGGCTTTTAGAATGCAGTTTCTCAATTGCTGTGG
ACATGACCATAAAAAAACTTCCACTAGGTTTTCTATCTGTTACTTTGCTAGCACTCAACC
TACTGGGAACATTTTATTAACCCTTTATTAAACTATTGTTTTCCCTCAAAAAAAAAAGAA
AAAAGAAAACTAATCTAGTGGGAGGCAGGTGCTGAAAACAGAGCATGCTGTGGTCAGGAA
TTTCCTGAAGAGACCTGAGTAGCAGTAAATCAAGATAAGGTTATTGTGCTGCTAAGTTAA
AGATTACATCTGTTCTTTACAGATGAATACTTTGTTCCTTGAAGCAAAAAAAAAGAGATA
AATGAGGCTTGTGATTTTTTTGTAACTTTATTGTATTGTAAATTTAAGATTATGCATGCA
GAATGCTTCATTGTTAGGGTATATAAGTAAGTAAGATAACACAGCAGCTAGGGTGCTGGC
CACATACATGGGAGCTGAAGGGTCCGAACCCAGCCTGGGCCTGCCAAACAACACTGACAA
CTTCAACTAAAAAATAGCCAGGCGTTGTGGTGGGCACCTGGAGTCCCAGCTACTCAGGAG
CCTGAGGCAAGACAATTGCTTCAGCCCAAGAGTCTGAGGTTGCTGTGAGCTATGACGACA
TAGCACTCTACCCAGGGCGACATAGTGAGGGGAAAAAAAAGTGCATCTTAGAGGCTGACC
TTTAAGTAAATGGTCAGAAATATACTGGGTTGATTGTGCTTGTTATCAAACTAACAAGCC
TTAAGTAATGTAAATGTTTGGGGCGGTGTATAGTGATTTTCCACCAACATTGGAGACCAG
AGACTCATGACAAGCACGTGGTCAATATATTGGCAGGTTTACAATTTAAGTCTTCCCAGC
TGGGAGGGACCGTCAATGTAGAAAGACTCTGAAAGCAGGCAGAGGGAGGCAGCTGCAGCC
TAGCAGAATTCTTAATCTATTTGGGCCTTATCTTTGGCAGTGACAAAGATAAGTCCAGGG
AACTAGAAAACTGGTTCCTGTCCCTGTTTGTATAATATCATCCTGTAGATGTTTCTATAA
ACGATTCTGTCATACCATCTTGTGCAGGAACTTTTCTTTTAACTACGTGATTGT
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved