Otolemur_garnettii Locus Mono:186:SNORA18
snOPY snoRNA Orthological Gene Database
Otolemur_garnettii Mono:186:SNORA18
Otolemur_garnettii
Mono:186:SNORA18
scaffold_54178
SNORA18
1001..1110
2110
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNATTCATAAAATAAAACTACAGGCTTGGCGCCTGTAGCTCAAGTGGCTAAGGTGCC
AGCCACATATACCAGAACTGGTGGGTTCGAATCCAGCTCAGGCCTGCCAGATAATGACAA
CTGCAACCAAAAAAAAAAAAAAAAAAAGACCAATTGCCAGGTGTTGGAGTGGGCACCTGT
AGTCCCAGCTATTTGGAAGGCTGAGGTAAGAGAATCACTTAAGCCCAGGAGTTGGAGGTT
GCTGTGAGCTGTGATGCCACAGTATGGTACCCAGGGCAACAGCTTGAGGCTCTATCTCAA
AACAAAAACAAAAACAAAAAAAAACAACTACGAAAGTATGAAAAGAAGCATAGCCACACA
TCACTGGAAATGTTTCATAGAGTAACTCTGTGGTTTTGTTTTACTCTCAAGACTATTTGT
TAGATCTATGGGAAGGAACTACAAGATGGTCACTAAAAGTATGAAAGACCTAATAATTTG
CTTCTCCTGTAGGCACTGGTGTGTCACACTGATCTACATTCTTCCTGTGTGTGATGGCTT
TAGGAACTAATTTGATTTGTGTCATTCATTTTTTGAGAGGGTGTCAAACTGAGAACCAGA
TAAATCCATGTACTCTCAAAATGACCCTTAAGTAAATTGCTTAAAGAAATTAGATCCCAA
AGATTCTTGGTGGGAAATTTGTTTTTTCATCAGTTTATTCACATGGAGATAAAAGTGGAG
ATAAAAGAAGCTAAAATAAAATAACTGTGACAAGTAACTTTTGGGGTGATAAGACATGGT
CTATCTTGAAGATAAATCTTCAAAAATTCTAGTGTTTGAGAAAGTAAGGTTACTTGATGA
ACAGTGGAAGGAATCACATGTGAAATTCCTTAAATAAAACTTTATTAACTTTAAATTTTA
AAAAAGTATGGGAAGAAGCCATGTGAGAATTCTTAAATACATCAGATTGAACAGAATTTA
TTTTTAACACAAAACCCAGGAAGAAAAAGTATTATTAAAAATTGACATAGGAGAGGGTCA
AGATGGTCGACAGGCACCAGTCTCTGACAGAAGCTCCTGTTCAGAGGAAAGGATAAAGTC
TGGAGAAACCCACAACAAAGTTGAAAACTGGGAGCCCAGCTGAGAGAGAAGAGCAATACC
GACAAGACACCTCTTCTGAGACAGGCAGAGACTCCTAGAGGACAATCACAGGTACATAAA
TCACCCCAAAGGAATAGCACCCATTCCCTCCCCCAAGAAAGATGTGCTTTTCCTTTGTTT
CCTCTTCAACCGCTCCTCCGAGTCTCCTACAGGCCACCGATAAACTGAGGACCTATTCTC
TCACTGCAGGAGTGAGTGCTGCCAACAGGGAAGTTTACTACCCTGGAGGAACCCAGTTGA
GACTGGGAACACCCTCTCTCAGGCAGAAAAGTGGAACTGACGTTCGCACTGCCATTTTGA
GTTTCCAGTCC
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved