Otolemur_garnettii Locus Mono:453:SNORA18
snOPY snoRNA Orthological Gene Database
Otolemur_garnettii Mono:453:SNORA18
Otolemur_garnettii
Mono:453:SNORA18
GeneScaffold_254
SNORA18
1001..1120
2120
GCTAGGATTATAAGCATGAGCCACCACACCCAGCTCCAAAATAATTTTTGGTAATACCA
CTATGTAATTTTTGGTACATAACTCTGAAGTTGAAAATAACTGGTGATGTTGTTATAACA
AAATTCCATCCATTCCTTTCTATTGATTTACGTGAATCAGATTCCACAGCATTTCTAGGG
GGAAATTCATCCTGAATTCTATGTCATTCTAGCAATCCAATAGGCAGTATTCATCTACAC
ATGAAATAATCGTGTACAAGGTTAGAGATAAAAACAGAACCTCATTGGCAGATACACTTC
TTCTTTTTTTTTTTTTAATACTCAGGGTTTATTGAAAGACAAAAGCTACAGAGTTAAGAC
AAACCTCAACAGTACAGGGGTGGCAGCAAGGGCAGATACACTTCTGTTTTGTTTTTTTTG
AGACAGGGTCTTTCTCTGTTGCCCAGGCTAGAGTGCAATAGCATCATCATAGCTCACAGC
AACCTCAAACTTATGGGCTCAAGAGATCCTCTTGCCTCAGCCTCCCAAGTAGCTGGGACT
ACAGGCACATACCACCATGGTTGGCTAATTTTTCTATTTTTTGGTAGAGACAGGGTACTG
ATATGTTGCTTACACTGGTGCCTCACCCTCCCAAAGTGTTATGATTATAGGTGTGAACAC
TTGTACCCAAGAGTAGATACACTTCTAATAATTTCTTTTCTTTTTTGGAATCTGCTAGAG
AACACAAAATTTTTCTTAATTTTTTTTTTTTTTTTTTTTGAGACAAGAGTCTCACTTTGT
CACCCTAGGTAGAGTGCTGTGGCATCATAGCTCACAGCAACGTCAAACTTTTGGACTTAA
GTGATTCTCTTCCCTAAGCCTCCGAAGTAGCTGTGACTACAGGCACCCACCACAATGCCT
GGCTAATTTTAGAGATGAAGTCTCACTTTAGCTCAGGCTGGTCTTGAACCTCAGCTTCCC
AGAGTGCTAGGATTATAGGCATGAGCCACTGTGCCTGGCACCTTTCTTAATATTTAATAA
TTACTTATTAAAACATATATTTATTCATAGAGTAATACTGCGGTTTTGCTTTATTTGTAG
GACTATTTGTTAGGTCTGTGGGACAGAACTACCAGACAATCAGTAAAAGAAAAAAAACAC
ATTTATGTTACTTTAATAAATAGTATAATTATGATAATTCTTTTTTTTTTTTGAGACAGA
GGTTTCACTTTACCCCCTGGTAGAGTGCTATGGCATCACAGCTCATAGCAACCTCCAACT
TCTGGGCTCAAGCGAATCTTCTGCCTCCACCTCCCAAGTAGCTGGGACCACAGGCGCCCG
GTACAATGCCCGACTATTTTTTGGATGCAGCTGCATTGTTGTTTGGTGGGCCCAGGCTGG
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNN
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved