Otolemur_garnettii Locus Mono:195:SNORD87
snOPY snoRNA Orthological Gene Database
Otolemur_garnettii Mono:195:SNORD87
Otolemur_garnettii
Mono:195:SNORD87
scaffold_61174
SNORD87
1001..1085
1752
CACTAATTTCTATAATACCTAGCATTTGACCTGGCTTAGCACATTCTAGTCGAACTCTG
AGACAGAAAAGCAATGATTATCTACTCATTAGAACCGTTGTGTCTTAAAATCAATACTGT
GATGATGGATATAAAATGTTTCCACCATTTATGTAATTTTTAGGTACTAACCAGTCAAAA
GATTTGAAAATACTCAAGTCACTAACAGGTGTTTTTAAATTTTGAGTTTGTTGGTTACTA
CTATCAAGAAGTAATAAAACAGGAATTGTGTTCTTTTATTCCATTAGAAATGAATTGAAC
AGATACTGGTATTTTTATTAAAAACTGGGTTAGAGTCCCCAAAGGTAGGGTGGGTTCCTT
ATAGGAATGAAATTTTTATTAGACTATTCCTTCATGTAACATGCCAAACAAGTGCAATTA
CAAACTGGAATTGACAGTGAAATATTTAATTTCTAGGTCTGACAAATCCTCTTGAGTTTT
GAAGGTGTGTGAAGGTCATAGTGACAGATGTTTTAAAAAAACTTAACAAAATGGTAATGA
AAAAGTAGAACCACCACCGGATATATTGAGGTATGAAAAATGTTAAATTACATCCTTTAT
GGGGTCTTGGTGCTATTGTTACTAACAGGCAATACCCCAAATGTTTGATGTTATTGCCAT
TGATCATGGCTGGCACAATGATGACTTAAATTTTTGCCGTTTACCCAGCTGAGGGTATCT
TTGAAGAAATAATTTTAAGACTGAGATGCCAGTAATCTATATTGGTTATGTTAATGGTGT
ATAATACAGCTTGTTTACTAAGAGATCAAATGTTCTTTCTCCTTAGCACATAGGTAGCTG
CAGATGCCTGTCCTTTAGCTGCAGTTTTTTGAAATACTCCTTTGTTACCTCAGGTAAGTA
ATTGTGACTAGTAAAGCAGCCACATCTGTTGACAGTTACATGTCTGATTAATCCAAGGGG
TTGGGGCTAATTCCTGTTGCTGTTGCATTTGCATGTCCGGATATGGTTTCCTTTCTCTCT
TTTTTTTTTATTGGAGACAGAGTCTCAAACTGCCACCCTGGGTAGAGTGCCATGACATCA
CAGCTCACAGAACTTTTGGGTTTCAGCAGTTCTCTTGCCTCAGCCTCCCAAATAGCTGGG
ACTACAGGCACCTGCCACAAGGCCCAGCTATTTTTTGGTTGTAGTTGTCATTGTTGTTTG
GCAAGTCTGGGCTAGATTTGAACCCACCAGCCTTGGTATATGTGGCTGACACCCCAAGCG
CTGAGCTATGGGTGCCAAACCGCAGCAAAAAGTCACTATCATTTGAGGTTATGTGGTTAA
CTTTATTTTTGATTATGAAATGATTTCACTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNN
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved