Otolemur_garnettii Locus Mono:383:SNORA67
snOPY snoRNA Orthological Gene Database
Otolemur_garnettii Mono:383:SNORA67
Otolemur_garnettii
Mono:383:SNORA67
GeneScaffold_3091
SNORA67
1001..1142
2142
GGCAGGCAGGGAGGTTCTTCGCAGACCAGCGCTACTCGTCCAGCTCATTCCACTGATGT
GCTCTGAAGGAGCTTCGTTCAGTTCTCACAGGAACCTTTCCTTCTTCCTACATAAGAAGG
AGGCTGGAATAGAGCGTGGCTGCTGGAGACCCCAGCATCCGAGGCAAGAGGAGCTTCCCG
GACCCAAAGCAGAACCAGGCAAAAGGCTGATATCCAGGAAGGGAAAGACAAACAATTCAC
GTTTTCTTATCCACAAAACAAACTTATGATCACTCCTACTGCAGGAAGTGAAGGCAAGAG
TAGAGCGTCAGGCCCAATTTCACACAGAAAGGGTCTAACACTTGTGTCTCCAAGCCAAAG
GGCAGAGACAGCCACCTCCTATTTAGGTAGAAAGAGCAGAGCTGTCAATCAGGGTCCCAG
CCATGGCCTGCAGCATGTGTCCCCCGAGGCTGGGGTTCTGTGGACGTCTGACAGGGGCAG
CATGGACAGTGATTCCCACTTAGTCCGTCTTGCTACAAATGGGTTTCCCACTTTTGCACT
GGGTGGAGTGACCCGTTGGCTCATTTCTCTTGCTCACTAGACTCTGCTTTTCCTAAGTGC
AGGCAGCTCTGGCATCTTTGTGCCCTGTGCATCCAGCATAACTCCTAGCACGGAGTAAGT
CCTTGTTGATAAATAGTATCTGAATTAAAGAATGAATGTTCACAACTGTACATGTTGTGT
CCTTCCCATCCCTTAGGTTCAAGGAATTTTTTATTTATAGGTGCCAAATATCTAAAAATA
AAACTCTGTGGAGGTGCAGATAATATTGTCACATGCCCGTCATCTGAATAGTGTTCATTT
CACCCTAGAGATGGATTTGTGCTCCCTTAATATTTTGAAATGTAAAACCATTAAAAATAT
AACTAAACAATAGCATTTATCATGCTAGAGTTAAAATACATAATTAAAGACAAATTTGCC
ACAGACCTTGAAGTAATTGTAAAATTAATATTACTTTGTAAGTTATAGATGAGTTCCTCT
CCAAGGGGCCAACTGGTACCCCTCTTAGGAAAGCGGCAGCTTGGAATTCAATCTGGCCTG
ACTAAGGTCTCTTAGGGACAGGGGATGCTGCTTTATTTTGTCTTCCTGGGGCTGCCTACA
TGTCTGCTTCAGTTTCTTTTGCTAGAATGTGTCCTTTTATTCACACATGGAAGTTGTTAT
TTAAGAAAAAAGATATAAATTATAACCATAGCTCCTATATACATTTGAAAATTGTACAAT
AAAGGCCATGATGCTGTATAAAAAGTAAAACTCCAGAGCAAAACCAGGCTATTTAAAAAT
AAATAACTTTGGGGCTTCAGAATGCAGGAAAAGTGGTTTCCTTAATGGAACACACCTGTT
GTTTCCTCTGCGCACTAAAGAGCTGGTTCTCCGTGGTGGCTGCACGTTGATACCACCCAG
AGCTGGAAGGAAGCACTGCCGCCCCGTCTCAGCCTCAATGTTTTGACTTATTCTGCTCAA
GGGCATAGCCTTGGCATTGGGGTACTTAAAGCTCCTGTGCTCTATTGGCCGACCACGCTG
AGATCCACGGGACGAGAGCGCTGCCAGGTGCTGGTTTGAAGATGGGCCCTCTTGTCCTGT
CTGTTTGCTGCTGGACACACGGAGAGCAACGAGATGCACTTTCTGCCCCTGACACGCACT
GCGGTAGGAAGCGTGTGGTTGCAGATAGGAGCTGACGTTTTAACTAAGCTCTCAAAAATA
GCTTCTAAACTCGTCAAAGGAGGGCTGACATCCCAGCCATCCTGTGTGCTTTAGCACACA
GTAGGAACTCAGTAACTTTTATAAAATTAAAATTAAACAAGAGCATGACTTCTGAACATT
TTGTGCAAGACTTCTTGCGCAATGTCTGAGGTTATCTCCTCCTGGAGTAGCCCGTAGCTG
CCGCATCACATTCCAGGCCTGGCATTGCGTGTTTGTTTAAAGCCACATTCTATCACCCTG
CAACTTGTGCTTATTGGTAGTGGCTGAAATTCGGCTCCAGGGCTGCTCCTAAGGTCTGGC
TCGGTTAAACTCAGGCTTTACTGTTTCTGCAGAATCAGGTAAGTGGTTGACAACATTTGC
TGTTTGTCTCAGCGCCCCAGGGCATGATGTTAATTCCACTGGC
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved