Otolemur_garnettii Locus Mono:432:SNORD31
snOPY snoRNA Orthological Gene Database
Otolemur_garnettii Mono:432:SNORD31
Otolemur_garnettii
Mono:432:SNORD31
GeneScaffold_2753
SNORD31
1001..1069
2069
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTACTTTTGTCTATATTTGTTAGGTTGA
CGAACAGTCAATACTTCAGAAAATTGTGTAAGAATCACAAGAATATCAAAAATTATTTTT
AACAAGGAATTTACCTTTTCTTATATTAAAAAATAACTCACTTTACCAGTGCTGAGTTGA
ATACCACCCCAGTCTGATAACTGTGACTGAAAAGTATTTTCTGAACTGAGAAAAAACAAT
AAAATAAAAAATAACTTCAGAGAATACCTCTGAAAATACAAGCAACTCATTTCGTTTCGT
ATGCTATTGTTTTCAAAAGTCTAAGTGAGTTCAACTTTTCTTTTTCTTTCTTTTTTTTTT
TGCAGTTTTTGGCCAGGGCTGGGTTTGAACCCACCACCTCTGGCATATGGGGCTGGTGCC
CTACTCCTTTGAGCCACAGGTGCTGCCCATGAGTTGAACTTTTCTAAACAAGTTGGCAAA
ATTTTTCAGATTCTTAACAATATTCAATCTTATTTTATGTTTAGAGTATCTTCTGATTGT
AATAGGGCAGATTCAGATTTATGCTCAAAGATGTTCGATGTCACATTATTTAGTTGAGAA
AAATAGAAATAAGAGAAAAATTAAGTTATGGTACTCCAAAAGTGTAACACCATGTGACCA
CTGAGTATTATGAATAAAAGATGTTAATGGCAAAGGAAAGTGAGCATCATAACAGAATAT
TAAATGGAAAACAAGACCTTGATGTATTTATGGAGCACAATCAATTACATAGAATATACT
GAACAAAAGAGACAAAATATAGAGCTTCCAAAAGATGGCCTCCCAGTGTGAGTCATCTTA
TAAATATATACTTACAGACTTCATTTTTTTGTAAAAGTATGAACTAGTTTTTGAAGAGTA
TTTTAGTAGTGGAACAAGTACCTCTGATTCTCATGTACTTCCTCTTTTCACTAAAAATTT
TGTCTGAAATTTCAGTGTAATGTTTACTTATATTCCTGCTCCAATTTCATGAAAATATTC
AAATCTACTTCAAAAAATCATTCTTTCTGAGCCTTGCATGTCATTTAGTATGTGTGTATG
ATTGATTGTTTATTTTCACACCTTATTTATATTGGGCTAAAGCTGGTACAGACTGTTTTT
GACAAATAGCTCTCACAACAGTTTTAGTGTTATATGAAGAAAAATGGGGAAAATGCGGAT
GGCATAACTTTGTGTCACTGTTTTTCTAAC
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved