Otolemur_garnettii Locus Mono:38:SNORA51
snOPY snoRNA Orthological Gene Database
Otolemur_garnettii Mono:38:SNORA51
Otolemur_garnettii
Mono:38:SNORA51
scaffold_92874
SNORA51
1001..1130
2130
CAGTGGAAAAAATTTTTTTGACATAGTGGTATCTCATATTTTAAAAAGCTAGAAGGGAC
TCAGAATTTTTTGTTTGTTTGTTTTGTCCAAATACTTTTTTTCTTAGACAAGATTCCCCA
AGGGTAACTTGCCAATTTCACAAAGTAGCAGCACAAGACAGAACCAAATGGCCAAGTCTC
ATTATGCTGGCTTTGGTGGCCCCCCTTGGAACCCAAAATATGTAAAACGTAATCTCCTTG
CTCAGCATCTATTAATCTGGGCAACCTCCCTAATGAAAAGAATGAGCATAATTTAAAACC
TTGCACTTTCCTTCTCTGCTCTGGCTATTCACATTTAGCAAAACAATTGTGGTGCTGAAG
CAACCTTTCATAATTGAGAGAGATGTGGACCTGTTACCGCAGAGCCTCAGACAATAAGCT
ATTTTCCATCATCACGTGGTACATTGTGCAATGTTCTAACCCAAGTGTTGGAACATGAAT
ATCACAATCAATTTAACAATTAGCATTTTCCGAGACAATAGGCACATTATTGCTTGGAAT
AGTGGCACACACTTTAAACAGAGAGCCATTGACCCCCTGCTTAATGGCAGCTTTAATCCT
TTTTATGTAGGCTTACTGAACAAGTGGACATCAGGAAAAATGTATATGGAAATTCACAAA
TACCATATTCTATTCTATTCAAGCAATATAACTTTCCACGTCTTCTCCAAAACTACTCAA
TAAAAAAATATGGACAAGATTAACTCCCTAAGTGATTTTTCACTAGCATGCATAGAAATT
TTCTAACCTTAGCATTACAATATTATATAAATTAATACATGTGTCATTTTACCAGATTGA
AAAGATAATTTATGCCTTAAGAAGAACCCAATTCATACTGCATCTTATAAGTTTAGCCAA
ATAAAATTATCCATTTCATACATAAATTGCTAAATTGCAGTTTTCCCTGTGACGGGCAAG
GGAAAGCAGGGTTTCTTTGAGTGTTAAAAATCAAAGGTTTCGACCTCCTGGTCTTACCAC
AGGCTGTGTTCTCACACTGACTGTATAGGAGGAGGAGGCCGAGGAAACCTACCCTCGGTC
CGCCCCAGCCAGGCCCCACGCCTGGTCCATTTTATGAACGGGGGAATATGGGGAAAAAAT
CAAAGGGATAAATTCCATTTCATTTCTAAAGTCACAGAGTATCTCTAGAGGACTGTTCAC
ATGGTGAGGGCATTTCCTTTCCCTGGTAAAATTTATAGCTATCAATGAAAAAAAAAATAG
GGGCCCATGTCACCCAGTCTGTAAAAGAATCGTGTTGGGGGGGGGGGGATGTGTTCAGGC
AAAGTGAGACTGTTGATCAGGAGGCTAATTAAATTGTGATCCTTGGAGTGGTGGGGGCAA
ACAGCAGAGTCATCAGGTGCAGGTGGTGGTAGGAGGATTGTCGGTGTCTCTCCTCCTCTA
TGGAAATGTCAGCAATTTGAGGGCAGAAACTGTCCNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved