Otolemur_garnettii Locus Mono:97:SNORA7
snOPY snoRNA Orthological Gene Database
Otolemur_garnettii Mono:97:SNORA7
Otolemur_garnettii
Mono:97:SNORA7
scaffold_104691
SNORA7
1001..1119
2119
ACACAGAAGGAGAAGGCACCAAGCCAAGGTGCAGCCTCAAACCAGCCTCGCCCACACCT
GGTGCCAGGGGAGCTTGGGTGCCTCAGTCGAGGCCAGAGAGGAGGGCAGAGAGCAGAGCA
GCCCTGTTCCCAGCACCAGAGAGTCACTGACCAAGGTCGCCTTCAGAGGAGGTGAATTCC
CAAACATCCCCAGTTTCAAGGAATCCTCTGGCCCTTTTCTAAAGAGTTTCAGGGGCTGTA
GAAGCAAAAGAACAAGAAATCTGGGAGAGAGTGCCTTGAAACTGGGGTTGATTTCACAAA
CATGAGATGGTTATTGCATGGGACATACAATTTGTCCATAAAGATTTTGTGAACTGTTTT
AAATTGTACATGAACTTTATGGACGCCTATATTCATCTGAGATTCGGATGTGGTGGCCTC
CTGTATTGTTTGTGGGAGTTCAAACCAGCAGGGACGAGGGGAGCTTAGCCATCTGCTTGT
GCTCTAACAGGGTGTGTTCAATGCTGAGAGAGCATTTAGGATTGGAGCCATGAGAAGGAC
TTCTCTGAACCATAATCTTCACAAAGTATGATCCCTGCTGCAAAATGTGTAAGGAAAGAG
AGACAAACATGTCTTAAGGCAGCTCGTTTCTCTGTGAACAATTCCAGTGGCTGGAACACC
TCCTTGCCCGTTTGGCTGCCGTACACCCTCCTGGGGCCAGTGGGGTTGTTAGGTTAGGTT
TTGTCCTGCTTCAGGCTGAAGACCCTGAATTCCTTCCAGTAATTGTCCCATTACTCTGCT
CCAGGAAGGTTCCAGGCAGCACTCTAGGTGTTAGCATTTCAAAGAAGACCTTTCTTATCT
TCGTCACAGATGTGCTCCATCCTGTAAAAGGTGCTAAGTGAGTATTTTCTGTAGTTTGAA
CACAGAGCTCCCATTGCTAATGTCCCACTAAGGTGTCATTATCCCTATATAAAATTTGCA
CTGAATTACATTGAAATGAATAATTAAACAAAGAGAATCATGACCTCCTGGGATGGCGTC
TGGAGAGCCCGTAGTGTTCTGCTGGCTTCGGTTGAAAACAGGAGGAAAAGAAAGCCCAGC
AGAGGTGCCCATTCCATTCCCAGCTGGTTCTGTAGCNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNN
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved