Otolemur_garnettii Locus Mono:293:SNORA48
snOPY snoRNA Orthological Gene Database
Otolemur_garnettii Mono:293:SNORA48
Otolemur_garnettii
Mono:293:SNORA48
GeneScaffold_2007
SNORA48
1001..1135
2135
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNTCTGGGCCCTGTCATCTGGAAAATTCAGGTAAGGACACAGGCAGTT
GTGGGACTCACCTCAGGGATGAACAGGTTGCCCTGGGGTTGGGCCCCTCACCTGGATTTC
CCCCTTTTAAGAAAAAGAACCTCCTTAATCAAACAACTCTTTATCCTTGACCTGGGCAGA
GTGACATCTGGTTGGTGGTGCCCATCTCATATCAGCCAGGGGCAAAGCAACCCCTTGCTT
ATCCCAGCTTGGCTTCTGGTCTGTGCCCATGCTTGGTTCATGCCTTGGACACATGGATTG
CTGCAGCAGAGAGGACTCTCTAAATCAGGCACCTATGGGGGTTCCCAATCTTGCCCGGAC
ATGTACATGTGGTAGGGGTAGTGGTTAGAGGAACAGAGACTCCTGCTCTCCAGTCTGAGT
CTCTCCCTCCCTCATAAAAAGCCACTGATCAGGCCGAGAGATTCAGACTGCTCCCCTTCA
GCTGCAGAGCCCACTGTCTCTGTTGCTGCCTTCAGGACTCCCTTGGACCCACCTTCAAAG
GTTGAGACCAGGCCTTGGACGCTGGAGGCCCGGGCTCTAGTCTAAGCTCTGCACTAACCT
TCTTTATGACCAACTCATCCTTACTCTGGGCCTCAGTTTCCCCATTACATATAATAAGAA
AATTGAACCAGATGATCCCCAGTTTCCTCTCATCTGTGACTCTTCTCTTCCCTTGAACAC
CTGCTGTGCCAAGACCTACCTGGGCCACTACTTCTCACAGCAGGAATGGGCCATTTCCAG
AGAAGAAACAGGAACTCTTTCCCAAGACTTGGTCTCTTCCCTCTCCTCTCTCCTCCAGGG
CTCTGTGGATGCTGAGGGGAAGCATCCCCAGTCTCCACTTTCTTCACACCATTCTCCCTG
ACATATTAACACTTGGCATTCCAAGCACGCCATGACATTAATCCTTGCCTCACTCCAGTG
GTGGAAATACTGTCATCAGCCTATTCTATAGATGACAGAACTAGGCACAAAGAGGAGACA
CAAGCAGCCCTACGCTATGCTGCTAGAAAGGGGTGGAGTCCAGACAGCCTGGCTTTACAG
CCTCACTCCAAAACACCACACCAGGGTGGTACCCAGCACTCCCCAGAAAGCATCTAATTT
CATCTTTACCATACTTTATAGTAAAGTGTCCATACCATACCTCATTCTGTGGTAAAGTGA
GACCTAGAGACACAAGTGACTTCCCTAAGGGGACAAAATGAGTTAGTGGCACAACCAGGA
CCAGAAGCCAGGTCTCTAACCTCAGACATCTTTGAG
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved