Otolemur_garnettii Locus Mono:112:SNORA8
snOPY snoRNA Orthological Gene Database
Otolemur_garnettii Mono:112:SNORA8
Otolemur_garnettii
Mono:112:SNORA8
scaffold_11587
SNORA8
1001..1138
2138
TTGGGTTCCCTTGACCTTTCCTAGTCCTGTGTGAACAAGAAAATGATGGTAAGAATGGC
AACTGCAGATTGTTTTACAGTTGACAAATACTTCTCCACCTAATATCTCATGTGATAAGA
AATAATTCCCTTATTTGACTGTAGTGCATGAATGTAGGTAATAAGTGTCCAATTTTACAA
ATACACAATCTGAGAGTCATTGAGTTAACCAGATTTCCAAAGGTCACCTGGGTACCAGTG
CTCAGATTCAACTCCAGGTCTCATTGAAAAAAAAAACATCTATTGGGGAACCACAGTGGC
AGTTCATAAGAGCTCTGCAGGGACATCGGGTGAGGTCAGAAACAGGAAAAGTCTTCAAAG
ATTGAGCCTCCATCTGGTCGTACCCAGGAAACCCAGGGAACACCTTTGCAAATGCACAGA
GTGATAAATGCTTATTGTAGAATGCTGAGAAAATTCAAAAAGAAGAAAGGAAGGAGGGAG
GGAGGAAGAAAGGACAATTCATTATAGCACAACCTGGAAATAGTCATTGTTGACACTTTG
GTATGTATCCTCGCGGACCTTTTTATTTGTTATTGTTTGGGATTCATTAAGGGTACAAAG
AACTGGGTTACACTGATTGCATTTGTTAGGTAAAGTCCCCCTCATAATTGTGTCCCACCT
CTAAGAGGTGTGCCCTACACTGTAATCCCTCTTCCTCCCCCTCCCTCTCTCCCTCCCTCA
TTGCCCTGCCCCCCACCTTGAATTGAGGTTTTCTCTTATGAGGGTATGCATTAGATCATC
TACTGCTCTCTGATGCAGAATCGAGTACATTGGATTCTTGCTTCTTCATTCTCATGATGC
TTTACTAAGAAGAATGTTCTATCTCCACCCTGGTTAATACAAAAGATGTAAAGTTTCCAT
CTTTTTAAATATCTGAACAGTATTCCATGTTCCCTCAGACCTTTCTGTTTGTCTTTTTTC
TTTTTCTTTTTTTTTTTTTTGAGACAAAGTCTCGCTTTCTTTGCACTGCATGGTATCTGC
ACCCAGCAGCTTACTCCTGCTGGGGTGTTCCAAGGTCAGTGCCATAGAAATTCAGTATTT
GGCATGTTGGTTTTCTTGGCTTTGTGCATGTTAAACCTGGTGTTTCTATTGATACAGTAT
AAAAAAAGAAAAACAAAAACCTTTCTCACTTTCTTGTCCTGAGTAGAGTGCCATGGCATC
ATTGTAGCTCACAGCAACCTCAAACTCTTGGGTTCCAGTGATCTTCTTGCCTCAGCCTCC
CAAATAGCTGGGACCATAGGCTGCCATCACAATGCCCAGCTTTATTTTTTTTTTTTAGTA
AAGACGGGGTCTGGTTTTAAACTCCTGAGCTCAAGCAATCCACCCACCTCAGCCTCCCAG
AGTGCTAGGATTACAGGTGTGAGCCACTGTGCCTGGCCTGACCTTTATTTTCTCTATTTA
TACCCATGGTATCCAGACGCATAGGTCGAGGTGCACCATCAACAGTGCTTACGGAATAGC
TTTCCCTGAAGTGACCCCGATCCTACCATCTCAGCTTAGTGGCTGCATAGTATTCTATCG
AATGGACAAACCACAAAGACAGAGCACTTCCTTTCTCTCGGACGTCAGACTGCCTCTGTA
GGCAGGCCCTTTGCGGGTCACAGAAACCTAATTATGCTGCAGGAAACGATTCACGATGTG
TTTGCCGTTCCTGGGCTCTGTCCTTTCCTCACTTGCTCTGGGAACCACGGACGCATTCCC
CGGAGGCCTGGCATGTAGTACGGGAGGTTAGGTTCCCAGGACAGCCAGACCTGCGGAGTT
GGGCGTCCTTTTGAAACAGAAAAAGGGAAGAAAGAGCCCAGCAGGAATCTTTCCTTTTCA
ATCCAAAAACATTTTATTTAAAAACAATATATGAAAAAGGGCAACAAAATGTACTGCTCT
CAGTGAGTCCTCAGCAAAGGGCTGTAGTGGCAGTTTGGGGGTTAGCGTGGTCTGCAGTGG
AGCTCATTGGGTTACTTGCCTAAGCTTTTGAAAATTAGAACAAAGTTTAGATGCCTTTGT
GGCTAACTCAGCTTCATTCTGGAAGCTTACTGCAGAAGGCAAAACACCTGGGAGCCAAAC
GGGAGCTGGGAAATCAGGTAACTCTGCGGCCAGACCAGT
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved