Otolemur_garnettii Locus Mono:84:SNORA64
snOPY snoRNA Orthological Gene Database
Otolemur_garnettii Mono:84:SNORA64
Otolemur_garnettii
Mono:84:SNORA64
scaffold_101583
SNORA64
1001..1135
2135
ACGAAACAAAACCACTCTCTTTATTTTCATCCTTCAAGCCTTAGCTCAAATGTAACCTC
TAGAAACCTTCCCCAATTCTCTCAGAGTTTGGTGCTCCCATAACAATGCAGTATTTCTGT
TTCCATCCACAGACCATACTATAATTGTTTCCATCCCCTTCCCAACCAGCCTTGACCTAT
TTGAGCTTGTATCGCTAGGATCTAGCACAAGGGGACGGGTGGAAGATGAGAAGCCACTGG
GTACTCTGCACTGTTCCAGAATCATCATGGTCAATGTTTCCTAACCATCTGGGGACATAG
CTCATCCTTTGAAAACCTGAGGAAAAGGGTATTAAGCTAAAAGTCACGAGATCTGGACTC
TACCCCTAGTTCTGACAAAAACTCTGAGTCTTCAAACCAGTCAATTACTCTCACGGTACC
TTACTTTCCCAATTGGCAAAGTAAAGAAATTACCATTTGTCCCTCAAGTAACCTTCATTA
AATGTCTATAATAAAAAATAAAAATATACACCAGAAATGAGGAGAAATTCTGAAATTAAA
ATTGTTATATAAGAGCAAATTATTTTTTATTATGCCTCGCAGCTTGATACTTGTACAGCT
ACCTATTCTGCCAAAAATCATGCTGTGAAATAAATTGACTATTTACTACTATAACTAAAA
GAACTGTTGTTTTTCCTAAAACCCCAAAGGCCCTGTAGTTTACATACCCCAGAGTGCGGG
AGCACAACAAGCAGAAAGAAGCAAAGATGAACAATTCAATTAATTCACAATTGCTCACAC
CATTGACTACAGATTCCTTTGATAACAATATGCTTCTGTATTAACAAACCTGTGAGACAA
TTGGCCAGTATGCTTTGAGATATTTACATTCTACATGTTAAGGATTCTTGATGACAGTAT
GAATATTCTGTTCTCTCTGCAGTCTGACCCTACCATTAACCACTGTTGCAGGTGGGCTAA
AGCCCACAGAACAATCCCCCTTCAGAAAGGGAAGCTATGGAATATTCTACCTACTGCACG
GTTACACTTGTCCTCACTTGTGTGACTTTCGTAATGTGGAAAGAAAGAAAAGTTCTCCTC
AGGATATCAGGTTGGCCTAACAGTGGCTCTCTCTTTCCTTGAGGGCTCTAACAGGGTAGA
GAGAATTGAAAAGAAAAGAAATATTTCTACCGAATGAGGCTTAAAAGACATACTTTAACC
AGGCTGATTTTAAAGCAATTTGTCAGGCAGCCACTTTGAAAGAGCTTCAGGAGCTCCACT
AAAATCAAATGAATAAAAGAACCCAGGGCCATCCTCTACATTTCNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved