Otolemur_garnettii Locus Mono:301:SNORA32
snOPY snoRNA Orthological Gene Database
Otolemur_garnettii Mono:301:SNORA32
Otolemur_garnettii
Mono:301:SNORA32
GeneScaffold_5598
SNORA32
1001..1121
2121
AAAGGAAAAGCATGCTATCCCCTAGGAAAGAAAATATAATTTAACTTCAAGTCATAATT
GCTACCATTAGAAAACCACTCAAGGCTGAGCTCACGTCTATAATCTTGGCATTCTGGGAG
GCCAACACAGGTGATCTCATGATCTCAGGAGTTCAAAACCAGGCTGAGCAAAGCAAGGCC
CAGTCTCTACTAAATACAAAAAAAAAAAAAACCTAGCTGGGCATTGTTGCAGTTGCCTGT
AGTAGTCATAGCTACTCAGGAGGCTGAGGCAAGAAGATGACTGAGCCCAAGAGGTTGAGG
TTGCTGTAAACTATGATGCCCCATATTCACTCAATCCCAGGGTGACAGAATAAGACTGTT
TCCCAAAAAAAAAAGAAAAACATTCAGAATCTGTTGTAGAAAGACTTTCATTTACATTTT
TCTTTAGCACATTTCTCCAAGAAAACCAACCCTATGATACCTATGGTATTTTCTTAAACA
TATATATAAGGGGCTTAATATAAACTGCCAACTAACCTTATCTTCATTTTGTAGTTTCAC
ATCATATTTGTGAGGCAGAAATTTTGGAGGAGCCCATTTCCTTTCTCCTTTTTTTAATGA
AGTAGGAAGTTTTCGTGGAGATCTACGTGCTCTGTCATCTAGTCAAATCAATAGAAAATT
CATTAAAAACATAGTTCTTTTAATTCTAATCATTCATCAGTAACAATAATCTTACTAAAC
AGTTACTCTGCACCAAGCACTAGGTGATACAACACAAAGATGAATCATGATGTTTTTAAC
TTCACAGAGCTAAAGTTTATAGGGGGAGTCAACAAGTAAAAAATTGTAATATGATATGAT
AAATAATGTAATAGAGATTGGTAAGGAAAAATACTATGAGAATATAGAGAAGGAACTGCT
AACTTAGTATAGAAGATAGGCAGGAAAGACCTAGAAAGAATATGAGTTGTTCAGATTGCA
AGCAATGAAGTTTGGCTGAATCAAAAATAAGATTAAAATACTGGCCATTACCAAGGTTTT
TAGAATGCAGTTCTCAATGGCTAAGGACATAACCATAAAAAAAATTTCCCACTAGGTTTT
CTATCTGCTACTCTGCTANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCC
ACAGAAAAGTTTTTGGTTTTTCTAACCAGATACACATTTTGGAAAGATCACTAATATAAA
AATAAGAAAATTTTAGCGGTTAGAAATGAAAAAACGGGCTCAGCGCCCATAGCACAGTAG
TGACGACACCGGCCACATGTATTGAGGCTGTCGAGTTCGAACCCAGGTAAACAATAATGA
CAACTGCAACAAAAAGTAGCTGTGCACTGTGGCAGGTACCTGTAGTCCTAGATACTTGGG
AGGCTGGAGGCAAGAGAATTGCTTAAGCCCAAGAGTTTGAGGTTGCTGAGCTGTGATGCC
ATGGCACTCTACCAAGGGCAAGGGCAACATAGTTAAGACTCTGTCTCAAAAAGGGGAAGG
TGAAACTGAAGGTAACAAAATCAGAAGCTACAATGTTAAACATCTAGATTCACATAACTA
GAACTAAGAAGGAAAGAAACTCAAGAGATATTTAGAAGATAGATTTGGTGACCAAATAGA
TGTGGGAATATTAAAGGTTTCCAGGTTTTCTGCCTTAGAAATTGAGCCAATGGTGGGCCA
AGTTAAGAGGATGTGGAGAAAACAGCAGAGTTCCTATTTGTCTTATGAGACAAAAAGTGT
GAGATCAATTTACCTTCAGGTGTGTTGAAATTCAGTTGCCCAGAAGATACACAAGTGAGC
ATTAGTTCTAGAGTTAAGAAGTCTGACCTAGGTTTAAGAATCATTAGTCTAGGGTGGTGC
CTGTGGCTCAGTGAGTAGGTGCTGGCCCCATATACCAAGGGCGACCTGTTTGAACCCTGC
CCCAGCCAAACTGCAACAAAAAAATAGCCAGGCGTTGTGGCAGGCGCCTGTAGTCCTAGC
TACTCAGGAGCCTAAGCCCAAAGCTGGAGGTTGCTGTGAGCTGTAACACCACAGCACTCT
ACCAAGGGTGATAAAGTGAGAC
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved