Otolemur_garnettii Locus Mono:101:SNORD77
snOPY snoRNA Orthological Gene Database
Otolemur_garnettii Mono:101:SNORD77
Otolemur_garnettii
Mono:101:SNORD77
scaffold_10443
SNORD77
1001..1067
2067
CCCTCTTCCAGTGGGAAATATACTAAATAAACAGAATGCCAATATAACATAATATAATA
ATGTGTTATATACATATATTTATATGTCATATAAATATAATATGACATCTGCTTAAGTAA
TTTGGTTATAGATTACTCACAGTACAAATTTTGAAGTCTAGTTATCAGAAAATTTTATCC
TAAAAGTACTATTTGTATAAGCATTCACCATTATATATCATGAGTTAAACAAAACACACA
AAAAACTAAATTGCAGGGCCAACACAATTGTAACAAACTGCAATTAAAAATAAAGCATCA
CTAAAAGGTAGAACACTCAATATAAACACTTACATGTGAGTTTTCCCAATACTATCTGAA
ATACATACATATGGAATTCTGTTTTTTTCTAAATAAGTATACTACTATGATCGACATTCT
TTTCCTTAAAATAAACTGCAATTACTGGAATCTTATGTCTCTGACACAGCCTTTGTAACA
TTTGGCTGTCTTAGCAAATTAAAGTAGTCAAAAATGTCAAGTAAAATGCTGATTTTAACT
TATGAACAGCAAACTTTAGTAACTCTTAGAGGCCTTAATTGCACACAAAATAATGGAAAT
GAAAGAAAGGACTATCATTTGCCTGTAGTCCCAGCTACTCAGGAGGCTGAGGCAAAAGAA
TTGTCTAAGCCCAGGAGTTGGAGGTTGCTGTGAGCTGTGTGATGCCCTAGCACTGTACTG
AGGGCGATAAAGAGAAACTCTTGTCTCTACAAAAAAAAAAAGAAGAAGAAGAAGGGACTA
TCATTTTTTTTAACCAATTGCTGTCTATTTGGAGAACCTAATGAAATGGGTAGCTTATTT
TGAAGCTTTAAACTATTAAATAATTTTAAATAATATGAATTACCAAACTGCTGATTGAAT
GTATGAATAATCATAAGTTTTAAATTTAAAAATGCAGAGCAAAAATAGTATTATCCACAC
TGGTGTTAAATGTATCTCCACATGCCTATAAAGTTTTGTTCATTCAAAAATTTTTCATCA
TTCAACAAATTGAATCATGATGAGATTTATTATTTGTCTGATGTATCTGGAAAGGAAGGA
AAAAAAATATGATCCTCTTGTGGGAAGAAGCTATTCCTTCCTCCATCTCATGTTCTGGGT
TCTGAGCACAGGCAGAACATAGAAGCACCAGATAATCAATTACCTATTCATTTATCTATA
TTTTTAACAAGTGTGCCCATCACTATTTTAGGCAGAGAGGAGGCAAGGGTGAACAGGGTA
GGTACAATTCCTGACCCCAAGGAGTTTACTTTCTAGTTTTAGGTAATAGACAATGAAAAA
GAAAGCAAAATAAGAAATTGTAGATTGGGTCAAATGTGGTTAAAAGCCTACATATCATAC
AGTACAATGACTGGGAGAAGATATTCTTAATATAGGGTGTTCAGGGAAAATCTTTCTCAG
GAGACAACATTTGAGCTAAGATCTGAATGACAAGGAACCACCCTAGATTTGGAGGTGGAA
GTTTCTGGGCAGAGAAAGTTGCAAATGCAAAGACTTTGAGGCAGGCACATTCAGAATGCT
TTAGGGAACTGCAGAAGGCACAGAACTGCCACCTGCATAGCAGCAGAGCAATGAGTAGAG
AGAATGGCTGCTGATGAGCTCAGGAATGTCAGCAGGGGCTGCCTATGGGAGCCCTGATCT
TTTAGATGTTTTTAGGAGTTGATGGGAGACCCTCTGGGTATTCTAAGCAGGAAATGATGT
GATTGGATTTGTGTATTACATGTACAAATCTCCCCAGTCCTTGCTGCTGTGGAAAAAAAG
CCTTAGATGATGAGTTACCATGGAATGAGAAAGGCTATATTGGAGGCCTCTCCAGAGAGT
GGCTGAAGGGTGAGGAAGATAGCTGGCCCCGGGAGGCAATAGGAAAAGAATAAAGTAGAA
TCACATGTCTTGGAGGTAGAAAAAAACAGAACTTGCTGACGTATTGATTGCAGCAAATGA
GGTAAAAATACCAAAAATAAAGTGTTGACTCTTGAGTTTTTAATTGAACAAAAGGATGGA
AGGAGTGGCATTTACCATGCTATCAGGA
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved