Otolemur_garnettii Locus Poly:5:SNORD113
snOPY snoRNA Orthological Gene Database
Otolemur_garnettii Poly:5:SNORD113
Otolemur_garnettii
Poly:5:SNORD113
scaffold_116158
SNORD113, SNORD113, SNORD113, SNORD113, SNORD113, SNORD113, SNORD113, SNORD113, SNORD113, SNORD113, SNORD113, SNORD113, SNORD113, SNORD113, SNORD113, SNORD113
1001..1069, 2791..2862, 4764..4838, 7740..7814, 8264..8341, 10848..10922, 12155..12226, 15482..15556, 17457..17532, 18441..18512, 19339..19408, 20371..20439, 21283..21352, 22259..22330, 23829..23902, 24809..24879
25879
AAGACTGACACATTCTCTTCATTGACCATTGCTTTCCACTTTCCATTTACTAAGTCATT
TCAATATTTAACAATTGGTGCTGTTACTTGTCTCCTATCCTTTAAAATAAAGGATAACAT
AATACCCACCAGTGATCCTATTTATCAGTGTCCATATGATAGTTTTTCAAAGGGTAACAT
TCTGAATCCATTTGTTTTACTTATGAACATATACACAAAGATCATGTTCTGAAACTTTTA
TGGTTCATGCATTTTGATTGTATTACAAAAAAAAATCAATGATAAAATTTCTATAATTGC
ATACAAAAGATGAAGAGAGTAAAGTATTGCCTAATTATAAAAATCTGGAAGCACTAATGT
TCATAAGTAAACAAATGGATTCAGAATGTTACCCTTTGGAAAACTATCATATGGACACTG
ATATAGGATCACTGGTGAGTATTATGTTATCCTTTATTTTAAAGGCTGGGAGACAAGTAA
CAGCATCAATTGTTAAATATTGAAATGACTTAGTAAATGGAAAGTAGAAAGCAATGGTCA
ATGAAGAGAATGTATCAGTCTTTTATAACTTATTCTGTTCTGTATTCCTTAAGGGGGAGG
CTTTCTGCTATTCAGAGATGAGTAATGGTCACATACTCCAGTCTATGGTTTTCCTCTATG
CATTAGGAGCATGGAGACCACTGTGAATAACAATCAAAGTTCTTATTTTACTTTGGGTGG
TTTGCTTAAGGGTGTTCACTGTATCATTGAAAATAAAGAATTATAATCAAAGCCAAGTGA
CAAATACAGAATTTGTATAAAGCACTCTATGAATTAATAGTTGTATGAAAAACTAAAGAT
AATAAAGGAGATACATTGATGTGAGATGATTCTATATATGGAATGGAAATTTCAAGGCTG
TGCTTAGGGTTTTTTTGAATAATAGGGTTTAAAATTTAAGTGAATTAACAGATTAATCAA
CAGACAATGTAGAAATGAATGAAGAAAAAGAATACCAACTTTGGATTTATGATGACTACT
GGTGGCGTATGAGTCACATACGATGAATACGTCTGATGTCTGAGGTCCATCACAGAAGAC
AGCTGCCTATTGTTTCTGTTTAAGTGATGTTATGGATAGATTCAGAGTGTAGAATGTATT
TATTTTGCCTTGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTGAAGTCAAAGAGAAATAAG
TGATACATGTTTGTCACCTCTTGGCTAATGATGATGAAGACAGTATAATTATAGATAATC
TTCATGTTTTGGGTCAGTGGCAAGGTTGAAATTGTTCATTTTCTTAGGGGAAAATGAAAT
AAAAATATATTAAATAATGATAGCCTAAATGACTAATGAAATGAAAGGTGAAAAGCAAGG
ATTAGTGGTAATAGTGTCTCAAAGTTGTTACTGTCTTCTGTGTTGTTTGTTTCTCAGAAT
GGTTGTACTTGTTCTGATTTGAGGATTCTTCCATGGTCATGTGCTGTTTATATCATGCCT
AAGAAGGAAGATGCACACCAATGTAATAGTCAAAGTCCTTAATAATACACAGTGTATTAT
TAAGAAGTGTGAAATATAGTCAAAGAAGGGCAGTGTTCTCTCTTCTTTCCTAAATATGGG
AGTTATGTGAAGATTGTATTTATAATGCTTCTATAATAAACTGAGGATAATGAGTGAAAC
ATATATTAATGTAGTAATTTTACATATAGACTAGGTATATGAAATTTATTCTTGGGGATT
TTGTGAATCATAGGACTGAAAATTATAAATAATGAATAAATGATTTAATCAATAAAAATG
TAGAATGAATGTAAAAAGGGATGATTAATATCGGATCAATGATGACTACCGGTGGCGTAT
GAGTTTTATATGATGAATACGTATCTGGAACTCTGAGGTCCGTAACAAATGGAATATGGC
CCATTCCCTCTGTTTCAAATGATATTATGTGTTGGGTTTTGCTTTTTACATTCATTCACT
TCATGCTATTATTATAATTAGATCAATGAAATAATTTATATACATATATGTACATTTTCT
TAAGGGGGCAAAGTGGTGAGATAAGATGTATTATTACATATTGATTATGTTTAAGCCCCA
AGAGAATTAAATATTACATTATTGTAAATTCTTTGATTACGGATGATACAGTGTAATTAA
AGGAAAACAGTGAACATCTGGGTCAAGGAAAATTCTAAGTTGTTTGTTTTCTTAATGAAA
ATAAAATGTGCCTTCCAAATAATGACTTCTCAGATGACTAAAGAAAAAATAATAAGCCAA
GATCAAGAAGGAATGTCTCAATTTTTTTTTAATGATCTGCTGTGTTCTGTAATCCTCAGA
ATGGATGCTTTCAAGATGATTTACTCACTCTTCTATGGTCACAAACTCTATGGTTGCATC
TACATGTTAGGAGCATAATGAGTCGTGTAAGTAGTAGTAATAGTTCTTGCTTTAACTATT
TTTCTAGAAATTATTTGCTTTAGTCTTAAAAAGTATTAAATATAATCAAAGAAGATGAAA
CATGTCCACTGATTAATATGAAACATTAGATTAATTAACCCATGTATGAAATATGGAGCT
TAGTTAACGAAAAAAATTTAAGTCTTTGTAGAAATTATTATATAGATGGATGTTAAGNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTTTATCCCCCCCCCCGATATAAG
GGGGGGGGTTCTAGAAAAGACAAAAAAGTCTTCGTTGTAAAATATTTTTTTTAGGGAGGT
TCAGGATAGTCCCCACACTTTCTCGTGTGTGGGAGTAATAAAAATAGATGGTAATAGAGA
CAGTGGTCTTTTCTGTACTAATGATGACAGCCAGTGGAAATGAGTTATGTACTGTGTATC
CGGAACTTTGAGGTCCAACAAAAGTGGGATCTAGCTCATTCCTCCTTTTCAAAGGGATCC
TATGAACAGATGCCAATAACTGAGTCTTTTTGAGTTCATGAATTTAGAAAATATTGTTAT
AAAAAATCAAGGACTGGATAAAAAATGTATAAATAAATAGAGATCAATAGGGTAAATCAT
TGTTTAATACTTTATAATGTATATTAAGGAAAATAAATATTAATATAAATTAGAATGGAT
AATATATGAGTGAATGTGCTTATGTCTTAGACAGTGTGACATAGGCTCTGATAGTTATTG
CTCTCAATCAGTTTTAACTTTGAAGTAGTTTATTTTATTAAGAAAAAGTTATCATAATTT
AATAACAGCCAACAGGATAATGCCAATGAATGGTGGAATATGTGGATTAATGGAGAAAAT
GTCTCAGTGTTTTTAATCTTTTCTATGTTTTGTACTTTTCAGAATGGATGCATCGATCTA
ATTTAAGAATTTTGCCTTGATCAAGACTTGTTTATCATTGTTACTGAACAGACTGATGTA
ATAGTCAAAGTTGTAGTGTGGTTTGGGTGGTTTGTTTAAGGGTATTTACTATATTATTAA
CAAAATATAAAATATAGTCAAATAGGGCCAAATGTAGTTCGGTAACAAATGTGGAAGTAT
TACATAAAGCATCTCTTGGATTAATAAATATGTGAAAAACTGATACTAATTATTTAAAGA
TATATATATGAATAATGTGAGAATGATTTTATATATAAATATCTACAAGCAATTATTTAT
GCTATAATTTAATTATGTGAATTATGAGTATTAGTGGATTAATAAAATAAAGTAAAATTG
CATGAAAATAAAGTAAGCCTTTCTTGGACCAATGATGAGAATTGCAGGCATATGAGTCTT
GGATGATGAATAATATGTGTCTGGAACTCTGAGGTTCAACAAAAAAGAAATCTGGTCTTT
CTTTTCATGCACTTTTATTTTATTCTTTTAATTGCATCAATAAAAGAATCAATAGACAAA
CATACAAATAAAAATGACTGTTTGAAGCATTGTCCAATTATAAAAATAGGTGGTGAGGCA
AGAAATACTATTGGTAAATATAGAAAATTCTGAAGTCCACAGAGAAATAAATAGTGTATA
TAAGTAATTGTATCTTTTTGGCTAAGTATGCTGTTGACATACTTANNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNCTATATATAATGAGCGAAGAATTCTGGACGGAGCT
TCCAGGAGAGACAAGTAGTCCATTTTCTTGGTAGAAGCTATCCTCTAGACACAGGTTATG
AATATATAAGATTTTTTTGTTGTTGTTTGATATGATGCCATGCATGGCATCATAGCTCCC
AGCAACCTCAAACTCCTGGGCCCATGCAATCCTCTGGCCTCAGCCTCTTGTGGGGATTAC
ATACAGGTGCCTGCCACAATGCCTGGCTCTTTTGTCTATTTTTGGTAGAGACAGGATCTT
GCTCTTGCTCAGAGTGGTCTCCAACTCCTGAGTCAAGCAATCCACCTGCCTTGGGCTTTC
CAGAGTGCTAGGATTATAGATGTGAACCATCATGGATGGCCCAAGATTTTTTATCTTGAA
CTTTGCAATCATATTTTAATTCCTTTGTAACTAGATCATTGGAAGAATCAATAAAGAAGT
AAATAAATTAATTAAATAGTATTCATTAAAAATATGTAGTGAACCAAGAAAGTTTTATTA
TGAAATCACTGAAGTCCAATTTGAATTAAATTTCAGCCAAGGTACCTCCCTGGCTAAGGA
TGATATAGACAGTGTGAATTTTAGATAGTTTACCTGTTCTGCCCTGTGCCAATTTTGATA
TATACTTGAAATTAATGGTTGCGTAAATGACTAACTAAAAGGTGAAAACTAAGGATATAT
AGAGATATTGTCTCAGATTTGTTGTTGTTGTTTATTTGTCTTCCCTGTCCTATTTTCCTC
ACAATGGACCTGCCTGAGCTGATTAGAGAATCTGCCCTGGTTGTGAACACTATGGTTGCA
TCTGTAATAAGAAGCTGGAGATCAATGTGAGTAATAATAGTTTGGGTGCTTTGTTTAAGG
GTACTCACTACATTATTAAAAATAATATAATCACATAAGGCAAATGTTAACATTGTACTT
TGGGATTAATATGAATCGTTCCACTCATTAATTGAGATGCATAGATGAGAAACAGGATGA
TTAATAAAAGTTATATTACTCTAAGCATAATTTTGCATACATAGGCTTTAAAAAATATTA
TCAGTGAATTAATGAATTAATAAACAATGTAGAAATGAATGAAGAGGAAGGAGCCTTTGC
TGGACCAATGATGATATCTGCCGGCGTATGAGTTGTGGATGATGAATAATAAATGTCTGG
AACTCTGAGGTCCAACACAAAAAAGTCTGAATAAGAAAGGATCAGTAGAGGAGTATCTAA
TTTTCAAAATTATTTTCTGTGCTCTGTACTCCTTAGAATGAATGATTTCAAGGTGACTTA
TTCATTCTTCCATGGCCACCAGCCCTGTGGTTGGCAGCTCTGTGTTGGACCAATGTGAGT
AATAGTCAACATTCTTGTCTTGGTTTAGATGGCTTGTTTCATTGCATCGCATAATGCCAA
CTGTTACCAATGACAAAAAAGTATTACATTGACTAATTTATGTGTAAAAACAAGATAATT
AATGAAGAAGATACTTTGATGTGAGATAATTCTATGTGCAGATTAGGAATGTCAAACCTA
TTTTTGGACTTTGTGAATCCTAGGGTTTTAAACTATTATTAGTGAATTAGTGATTAAAGC
AGTAGACAATGTAGAAATGAATGGAGAAAAGGAGGACTTAATCCTGGATCAGTGATGACT
ACTGGTTGCGTGACATTATGAGTGAAATATGATGAATACATATATGGAACTCTCAGGTCC
ATCAGAAAAGGAATATGGTCCTTGTATTTATTCATTTTTATTCTATTATTATGATTGGAT
CAATGAATGAATCAACAAAGACATATAAATAAATCAAAATAAAATATGTGAAGCCTTGTC
TAATTATAAAAATTTGTGGCAAGGCAAGAAAGTCTGTTATGTATATTGAAAATACTGAAA
TCCAGAAGAGTTCTTTTTGGCTAAGGATGATATAGTCAGTATAAATTATAGACATTGTTT
TAATTTTGGGTCTGTGGCAAATTCAAAGAGGTTTATTTTAAGAAAGGATAATATAAATAT
ACTTCAAATAATGATTGCCTTAAATGAATGACTAAGTAAAAGATGATAATAAGCAAGGAT
AGATGAAGAAATGTCTCATTTCTTTAATCATCTATTCTGCTCTGTACTCCTCAGAATGGA
TAGTTCCGGGATGGTTAGCGCACTCTTCCATGCTTTCCAGCCCCATTGGCTGCATCTCTG
GGGTTAGAATATGAAGATCAATGTGAGTCAGTGGGTCTGGTATTTAAGTTATTTTTGTTA
AAGGTATTTAGTAAATCAGTAAAAAGTATTAAATATAATCAAAAGAATTCCAAGGAAGCT
AATTTTTTTTTTTTTTGGAGACAGAGTCTCATTATGTCTTCCCTTTGGTAGAGTGCTGTG
GCATCACAGCTCCACAGCAACTTTCAAACTCTTGGGCTTAAAGTGAATCTCTTGCCTCAG
CTTCCCAGGAGCTGGGCCACAACGCCTGGCTATTTTTTTTTTTTTTTTTATGGTTTGCAG
TTGTCATTGATGTTTAGCAGGCCCCAGCCTGGGCTCCGAACCTGCCAGCCCTCCNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNAAAATTTATAGTAA
GGAAATGGACATTTTTAATTATAATGGATAGGTGGAAAGGTATTTTGCTTTGAACTAAGT
ATGACAAAACTGAAGATAGTTAATAGGGTAATAGTCACTTATTGCTTCTCTGTGCATATT
TAAAATTTACTTTATTAAGAGAAAAACAAATAAATATTACCATTAATTAATAGGAGCATT
AAAATCATGTTAATTGATGGTAGAAAATATGGATCAATGAAAAGAAGATCTCGTTATTTT
TGTCATCTTTCTCTGCTTTTATACTCTTCAGAATGAATACACTAAGCTGATTGAAACCTT
TTGCTGTGATCAAGATTGATATGCTGCCTCTGTGTTAGGAAAGAAATCAAGATAAGTTAT
AGTCAGACTTCTTGTCTTGGTGTGGGTAATTTGTTTGAGGCCATTTGTGTATTATTATAA
AAAGTATTATATTACTCAGGAAGATGGGAGAAATAAGTTTAAGAGATGTGTTGTACAATA
TGGTGACTATATAATAATAGTATATTGTATTCTTACAAAATGCTGAGAGTGAATGTTTAA
GTGTTCTTAACATAGAAATAGCTATATGATGTAATTCTTATGCTAACTAGCTAGATTTAG
TTTTTCTACAATATGTATATTTCAGAATATTATGCTGTACATGAAAAATACATATAATTT
AATCTGCCAATTTAAATAAAAATGTAAACATATTAAATTAAAAACTTAACCTTGGATTAT
TGACAAGTATTATATGAGACATTGCATTATTCTATTATGTATGACACTTAGGTCAACTAA
TGAAAGAAATATAGTCTATACTTAAAATAATTCTATAGATAGATCTTATAGATATTTAAG
GACTTTGTTGAGTTTTTTGAACCATTTATCTGTTTTTATTAATATCAATAAATTAATCAT
TTAATTGATGAAAATGTAGGAACAAATGAAGACAATGAGACCCAGTCATGGACCAATGAT
GACAAGTGGTGGCATTTGAGTCATGGATGATGAATAATATGTGTCTGAAACTCTGAGGTC
CAACATAAAACCTAATTAGTCTCTTCCTTTTTTTGAATGGACTCTATGGATGAATGTCAG
GAATGTATAAAGACAATTCCCTTGCATTAATTCAGTTTATTTAGATTTATTATTATTAGT
AGATCAATGATAGATTCACTAAACTAATATAAATTAATAAATAAAGAAGAGGGCCAAGCA
TTGACCACCTATGAACATATGTGTGTAGGTGAGAAATATTAATAAAAATTGAAACCACTG
ATAGTCATTTAGAAATAAATAAATAAATATTTATTTACCAATTTGAATGATTTATCTTAC
CACTTTGGGTAAGAATCATATAAGTAAGACTCTTACTGAAAAGTAAGAGTCAACTTTATT
ATTGTAGGTTAGTCCTTTTTTTTTTTTTGAGACAGAGCCTCAAGCTGTCCCCCTGGGCAG
AGTGCCGTGGCATTACAGCTCACAGCAACCTCCAACTCCTGGGCTCAAGCGAGTCTCCTG
CCTCCGCCTCCCAAGCAGCTGGGACCACAGGCGCCCGCCACAACGCCTGGCTATTTTTTG
GTTGCAGCCATCATTGTTGTTTGGCGGGTCCGGGCTGGGGATTCGAACCTGCCACCTTAG
GTGTACGTGGCTGGCGCCTTAGCAGGTTGAGCTATAGCGCGCCGAGCCATTGTAGGTTAG
TCTTAAGGGAGATGTGTTTCTTTTGTTAAGATAAATATTTGCATACAACTACTCACAGTG
AATAAGCAATACATACTTAATTGGTTGAGTAAATGAAATGTAGCAAGCAAGAATAATAGA
AATAAAGTTTTAATTTTTTTTTTATCTGCTTTGCTTTGTACTCTTAGAATGGACATACTT
CAGGTGATTTAAGCTTTCTTCCATTGTAATGGACCCTATGGTTATCTCTATGTATTAAGA
GCACCGAGATTAAAGTAAGTAATGATTTGATTTCTTTTCCTGGTTTCAGTATTTTTTATC
TTAATATCATTCACAATAATATCATATTATTAAAAAGTATGAAATATAATTAAATAATTC
AATGATAGCCCAATGGTACATGTGGAATATATAACATGTCAATTAATGCACATATGAAAA
ATGGAAGATAATTAAAAAAATGATACATGGATATTCTAAATAATTCTCTATACAGATATA
GAGGCTCTTTTTGAACCTTCGTAAATGATAGTGTTTTAAAATTAGCATATTTTGATTTAA
TAAATTAATCAATAAACAAATGTAGGTGACAATCTTGGATCTGTGATGACGACTCGTGGC
ATATGAGTCACAGACGATGAATACATGTCTGAAACTCTGAGGTCCAATGTGAAATATACA
TAGTTCATATCCTCCGTCTGACATGGTCTTATAAACAGATGTCAGAAATATAAAAGGATT
TTGGTTTTAACCTTTGTTCATCCATTTTCATTCTATGCATAGAAAAATCTCACTTTTTTT
TTTTTATCATTTCCTCTGCTTTATATTTCTCAGAATGGACCCTCTCAAACTGATTTTATA
ATTCTTCCTTCATCACAAGCTTTTTGGTTTCATCTCTGTGATAGGAGCTTAGCGAACAAA
GTGAGTAATAGCTTAAGTTCTTATCTTGTTCTGGGTGGTTTGTTTAAGGAGAGTCACTAT
ATTATTAATAAGTGTGGAATAAATTCAGAGAAAGTGAACTATAGCCTAGTAATAAACATG
AAGTTAATATGAAGTATTATATTGTTTAATGTATATGGGAAATATTAAAGATAATTAATG
AAAGAGATATATTAATGGAGAATGATTCAAAGTACATATTATGGATATCAAGTCTCTTGG
GTTTTTGTGAATCATGGAGCTTTTAAAGTATAATTACTGAATTAATCAATAAATAATTTA
GAAATTTATGCAAGAAAAGTAGGTCGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNCTTTGAGTCAAAAGGGCAAATAAATGGGTCTTGAC
TCGAAGGTCCGATCCAAAAGGAATCTCCATGATACATGGTTTCTGGATCCCTAATGATCC
GCATCATTGAAAACTAATATAAAATAAATAAAAAGTCACAAATCAAAACAAAAAGGAATC
TGTCCATTCTCCCTTTGAGAAGTACTATTTCCCAGATGTCCCAAGTATACAAAATTGGTT
TTTGTTCTATAACATGTACATAGCATGTGCAAAAGTTGCTATTTTTAGAATATGAAATAA
ATATATTTTAAATAATGATTACTTAGATGAAGAATGAGGATCTTTAGGGTAATGTCTCAG
TTTTTTTAATCAAATGTTTTGCTTTGTACTTCTCAGAATGGACCCACCTGAGCTGATTTA
AGAAGCACTCTTCCAAGGCTATGTGCTCTAGGGTTACATCTGTGTCATTGGTCACACTGA
CCAGTGTGAGTATGTCCATTTCCTCTGTTTGAACTGTTCAATAAATTAATGTCAAGAATA
TAGAAGGATCTTATTCTTGTCTTTTGTGTTCATGAATTCTGAAAAATAACATTATAAAGT
ATAAATGGTAGAATAAATAAATTTATAATGAATAAACATCAAGTTGGTAAAGCATGGTCA
TTGTTAAACTCTGCAGTAAGGAAAACTCATTAATATAAGTGGAATAAATATATTTTGTCT
TAGATGAAAGGTGATAATAAAATGTACTACATAATAGCTTTGATGAGTTTCATATTTTGT
GTTTGATTTATTTATTTATTTATTTATTTATTTTTTTGAGACAGAGCCTCAAGCTATCCC
CCTGGGTAGAGTGCCATGGCATTACAGCTCACAGCAACCTCCCACTCCTGGGCTCAAGCG
AGTCTCCTGCCTCCGCCTCCCAAGTAGCTGGGACCACAGGCGCCCGCCACAACGCCCGGC
TATTTTTTGGTTGCAGCCGTCATTGTTGTTTGGCGGGTCCGGGCTGGGGATTCGAACCCG
CCACCTTAGGTGTACGTGGCTGGCGCCTTAGCCGGTTGAGCTGTAGGCGCTGAGCCTGTG
TTTGATTTATTAAGAGGAAAATAAGCAAATATTAACATAAAAGTTATATGTAGGTCAAGA
CAAACGTTTTGAGATAGAATGTGTTATGATCCATTATTTCACTACCAAGAATAAAAGTCA
ACAGTCAATAGCATCCTTTCTGATTTAACTGTGTTGCTCTGCTTATCAGTATTGCAAGGA
GGGCTTTGTTCGTTTTCATCCACTTGGATTTTACATTTCTTCATTGTTACATACCTTAAA
ATTTTTGTAATGACCCATGTAAAAACCTGAATGACTATATGAAGGGATAGAGAAATCTAT
GGCTCAATGGAGAGAAGGTCTCAATTTTTTAATCATTTACTGTGCTATACACTCCTTAGC
ATGGACGTGCTCTTGCTGATTTAATCCATGATCATTAGTTTGCATCTGTGTGTTCGATGC
ACAGAGACCAATGTGAACAATAGTCAAAGTTGTCTTGGTTTGGGTGATTCAAAGTGTGTC
AGTCGTATTAGATACATATAAAGTATTATGTTGATTAATACATAATATAAATACAATAAT
AGAAATTCAATTCAAGAAAGGTATTTAGACTCTTGGTAAATGGCAGTGTAGTTGCATGTT
ATGGATAATGAAAAACTATTCTTTTTGTGGTTTATGTATATTTTATTAACGAATTAATCA
ATAAACAAGTATAGGTCAGGAGTGGTGGCTCATGCCTATAATCCTAGCACTCTGGGAGGT
CGAGTTGGGTGGATTGCCTTGAGCTCAGTAGTTCGAGACCAGCCTGAGCTAGAGTAAGAC
TCTGTCTCTACGAAAAAAAAAAAAAAAAAAAAAGCCAGGCATTGTGGTGGGTGCCTGTAA
TTCCAGCTAGTGGGGAGGCTGAGGCAAAAGAATCACTTGAGCCCAAGAGTTGGAGGTTGC
TGTGAGCTATGTTGCCATGGCAGTCTACTGAGGGCCACAAAGTGACACTCTGTTTAAATA
AATAAATAAATAAATAAAATTTAGAAAAAAGAAAATTAAAAGAAACTTTAAACTAAAACA
ATTGAAAGCAAAATTAAAAAAAAATACTTATAGATAAGAAAGAAGAGAAAAAAGCTCAGT
CCTGGACCAGTGATGACAACTGGTGTATATTATTGTTGTATATGATGAATAGTACATGTA
CAACCTTTGAGCTCCAACACAAATAGAATGTAGTGTTTTCCCATGNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNATATGAAGGCTTATCTTGATAATGAACATATGA
AAACTGAGAATAGTTAATGAAACAGGCATAGTAATGTTAGAATGATTCTATGTAGAGATT
AGGAGTATTATGTCTCTTCTTTGGATCTTATGAAACAGTTTTTCAAATTGTTATTGATGA
ATTAATAAACTAATCATAAACAATATAAAAGTGACTGGAGAAAAAGAGGGCCAATCCTGG
ATCGATGATGACTACTGGTGGCAGGCATATGAGTGTTACACGATGAATATGTGTCTGGAA
CTCTGAGGTCCATCACAAAAGAAATCTGGCCCATTCTCTTTGTTGGGAAGATCCTGTAGA
CCAATGTCAGGAAATACAATGTATTTGTTTTGGTCTTCGTGTTCATGTATTTTCATTCCA
TTTTTATAGCTTCATTAATGTAAGAATCAATAAACAAATATTAAAACAAATATATTTATT
TGAGTGAAGCATTGTCCAATTAAAAAAGTGTGATGAGGCAAGACATATTATATGTATTGA
AAATGGTAAAGTCCAAAGAAAAATAAATGGTCCATGCCTGTCACATCTTTTGCAAATGAT
AGTATAGGCAGTATAATTATAGATAATAATGTTCATGATCTGGGTCAGTAGCAATTTCAA
AATTGTTCATTTACTTAAAATAAGATGAAAGAAATATACTTTAATGATAGCCTAAATGAC
TAATTAAAAAAACATGAAAATTAAGGATGAATGGTTATAATATCTCAAATTTGTTATCTT
CTTTGCTCTATTCTCCTCAGAATGGATGTACTTGCTCTGGCTTGAGGATTCATCCAGGGT
AATGTGCTTTTTTATTGCACCATACTTTAGAAGACAGATGCAGACCAATGTGTGCAGTAG
TCAACATCCTGATCTTGATTTGGGTGGTGTATTTAAGAATATTAAATCTGTTATTGAAAG
TAAATATATTGTCAAAAATGACCAACATTATCCCAATAATAGATGCTAGAGTAATTATGA
AGTATTATATTGATAGTCCATATTTTAGAAACTGAGGATATTTGACAAAACAGATATATC
AATGTTAGAATGAGTCCATGTACAGATGAGGATAATCAAGGCTCTTAGAGTTTTCTTTAA
TCTTAGGCTTTAAAATTATTGTTAGTAAATTAATGACTTAATTGGCAATCTAGAAATGAA
TGAGAAAAGAAGGACCAGTCTTGGATGGATGATGAATACTCATGTCATATATGTCAAATA
TGATGAATATGTGTCTGGAGCTCTGAGATTTGTCACAGAAGATAACTGCCCCATTCCCTC
TATTTCAAGTGATCCTATATAGACCAAGGTCAGAAACATAGAATGAAGTTGTTTTTGGTG
TTGGTGTTCATGCATTTACATTTTATTTTTATAATTGGGGCAAGGCAAGAATCTTTAAAC
ATATAAATGAATAAACATAAAATGGATGAGCAATTGTACAATTATAAAAATATGCAGTGA
GGAAAGAAGTACTACTAACATATATTAAAATCAGTGAAGTCCAAAGAGATATTTTATAAA
TTATAGATCAAATTCTTAGTCATTTGTAAGATCAAGATCCTAAGAAAATGAAATAAATAT
TAGTCCACATAATGATGGCCTAAAGCAAAGTTAAAAAGCCAAGATCATTAGTGAGAATGT
CTCAATGTCATTAACTTTTTAGCTCTGTACTCTTCTATAGATGATATGTGCAGATTTGAG
GATTTCACGGTCATATGCCCCATTTGCATCACATATGGGAGTATGCAGACCAATGTGAGT
AGTCCAAGTTCTAGTATTAGTTTGGGTGTTTTTTTTTTTTTTTTAAAGATATAATATAAA
TCAAAGATGGCCAACTATATCCCAGAGATAGATTTAGGAAAGATATTAAGTGCTATATTG
GTAATACGTGAAAAACTGAAGATTACTTAATGAAGTAAATATTAATGCATCAATATTAGA
ATGATTCTGCAGGCAGATTAGGAATATCAATGTTGTTCTTCGTCTTTTGTGAACCAAATG
TTTTAGAATTATCATCAGTGAGCTAATAAAGTATTTAATAGATAAAGTAAAAACTAATGG
AGAAATGTAGGATGAATTGTGGATCGCTGATGACTTCTGGTGGCGTATGAGTCTTGTACG
ATGAATACGTCTGGAACTCTGAGGTCCATTACAGAAGAAATCTGGCCTATTCTCTGTGTT
TCACATGATATAGAAAGATTTTAGAAAAGATAGAATGTATTTGTTTTTTCTGTGTAATTA
TATATTTACATTTGATTTATTTTTATAATTGGATTAATATGGAAATCTATAAACAAATAT
ATAAATAAATGAAGAGAAAGTGGTTGAAATATTGTCCAGTTATAAAAATATCTGGTGAGG
GAGGATATACTATTAATATATATTAAAAACAGAGAAGTTGGTCGGCCGCCTAATAGCTCA
ACCGGCTAAGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNGATTCAATGTCTTATAAAAAGACATTGATTAAATATGGCAAACTGTATTCCA
ATGGCAGATATTGCAGTAATATGAAGTATTACATTAATAATGCATACATGAAAATCTAAG
GCTAATCAATGCAACCTATATATCTATGCTAGAATGATTTTTGTTCAGAGAGCAGGAATA
TTAAAGCTATTTATAGGATTTAAAATTATTGGTGGTAAAGTAATAAATTAATCAATAGAT
GAGATATCATTGAATGGAAACTGGTCAGTCTTGGATCGATGATGACTACTGGTGGCGTAT
TAGTCTTGTACTATGAATACGTCCGAAGTCTGAGGTCCGTCACAGAAGTTATCTGGCCTT
TTGCATCTGTTTCAAATGATTCTAGAGACAGGTTTTAGAAATATAGAAGGTACTTTTATA
ATTGGCCAATGTGAAAGTCAGTGAAAATGTGTATGTAAATAGAGATGAAAAAGTTTAAGC
ATTGTCCAAATTTAAAAATTGGTTGTGATTGTAAAGAAATATTCTTAATATTTATTGAAA
TAAGAAAGTCCACAGAGAGATACATGGTACCTGACTATGATTTCTGTGGCTAATGATGGT
GTAGACAGTATAAAGTATAGATAGTGCTGAATTTCTAGGGCAATGGCAAGTTTTAAATTA
ATCATTTCCTTAGATAAAATAAATGAAATATAATTCAATATGGATTACTAATGATAAGTA
GAAAGCAAGGATCAGTGGTGATATTATCTCACTTTTGTTATCATCTTCTCTGCTTTATAT
TCCTTAGAATATCTGTACTTTGCTGATTCATGGGTTCCTCCAAGGTCACATACTATATTT
GCACCATGCTTAGGAAGGAGCCTACAGACCTATGTGAGTCAAAGTCCTTATCTTGTTTTG
TTTATAAGGATTCAGTGTCTTACAAAAAGGCACATATTATAATTAAAGATGGCAAACTCA
AGAATAAACATAGCAGTACAGTGAGGTATTATTGAAAATGCATATGTGAAAAACTAAGGA
TAATAAATAAAATAAATACATCAATATTAGAATGATTCTGTATACAAATAGCGATGGCTG
TTCTTGCAGTTTTATAAACTGTAGGACTTAAAATTATTATTCTTACATTAATAAATTAAT
CAAAAGAAGCTAGAAAGGAAAGCAAAGAAAAGAGGGCCAATTCTGGATCAATGATGACCA
CAGGGGGTGTATGAGTTATAGACGATGAATATGCCTGAAACTCTGAGGTCCACCACAAAG
AAAATGTAGCCCATTGTGTATGTTTGAAATTATTCTATAGACAGATTTCAAAAACATAGA
CTGTATTTGATTTTGGTATTCATATTTACATATTTCTATTCTATTTTCATAATTGGTCAA
TGTGAGAATTAATAAATAAATATATAAATAAATAAAAAAGAATAATGTTAGATATTGTCC
AATTATAAATATATATATGTTTTTTGAAATGTATGCATTTTGAAATGCAAGGAATACTCT
TAATATATTTTGAAACAGCGAAGTCCACAGAGAAATAAATATTTCATGCCTGTGACTTCT
TTGGCTAATAATATTCAATTTTTGGGTCAGTGGCAAATTTGAAATTTTTCTTTTTCTTTA
GAGAAAATGAATTAAATATATTGACTGCAATAATGATTGCATAAATGACTAGCTAATAAT
AGGTGAAAAGCCAGGATCAATATTTAAAATGTGTAAATTTTATCATCTTCTCCACTCTAC
ACTCCTCAGAATGGATGACTTCTCTATGACTAGGTGCTCTGTTTGAACCATGCTTAGGAA
GGAGCATGCAGACAAATGTGAGTAATAGTCAAATGTTCTTGACTTGGTGCAGGTGGGTTT
GTTTAAGAGGACTCAATGCATTATAAAAAAGTGCATAATATAATATGTTCAGAGATAGCC
AGCTGTATCCCAGTGATACTTATGGCAGTGGATATGAAGTACTTATTGATAATGCACATA
TAAAAACCTAAGAATAGTTATTAAAACAGATATATTAATATTAGAATGATTATCCAAATT
AGAAATATCAAGTCTATTCTTGGAGTTTGTGAAATATAAGATTTGTAATTATTAGACGTG
AATTAATGAATCAATCTATTGACAATGTAGAAAGGAATGGAGAAATAGAGGGTCAATCTT
GGATCGGTGATGACCACTGGTGGAGTATGAGTTATACACGGTGAATACGTGTCTGGAACT
CTGAGGTCCTTGATAAAAGTCAATTCCCTCTATTTCAAACAATTCTATAAGGAGATGTAA
AGAATATAGGATATGTTTGGTTTTGGTTTTCTGTTCACATGCATACTCATTTCATTTTAT
AATTTGATCAATGAATCAATAAAAAGTTATGAATAAAGACAAATAAAGCTAAGCATTGTC
TAATTATAAAAATATATGGTGATGCAAGAAATATTAATACCTATTTAAACAAGTGAAAGC
TAGAAAAATAATACATACTTAACTTTTTTAGATAATAATTTATAGATAGCTTAGATTATT
AACATTGTTCATGTTCCAGTTTCGTGGCAAGTTAAAAATTGTTCATTTTCTTAAAGATAA
AATGAAATAAGTATGCTTCAAATAATGCTTACTTAATCTAACTGATGATAGGTAAAAAAG
GAAGGATCAATGATGAGACCATCTTAATTTTGTTATCATATTCTGTGCTCTGTACTTGTC
AGAATGAACGTTTGTGATGACTTAAAGATTCTGCCAAGGTCACATGCTTTATTTGCACCA
TGCTTCAGAAGGAGCATGCAAGATAATGTAAGTAGTCAACATTCTTATCTTAGTTTGGGT
GGTTTGTTTAAGAGGATTCAGTGTATTATAAAAAAGGTATATAATACAATAAAAGATGGC
CAAATGTATCTTAGTTATAGATATAGGAATGATTCGAAGTATTATATTGAATACCCAAGG
CTGTTCTTGGGTTTTTGAAAACCAAAGGTTTTTAAATTATTAGTAAAGGTTATGGACTAA
TCAATAGAGAAAGTACAATGTATGGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNTGTGATTAATTAAATAGATATGTCAATGTTAAAATGATT
CCATATACAGATTAGGAATATAAAGGCTGTCTTTGGTGTTTTGAATCATAGGAGCTAAAA
TTATTCATAGTGAATTAATGAATCTGTCAATAGACAAGGGTAGAACCTATGAGACAAAAA
GATCAATCCTGAATAGGTGATGACTGCTGGTGGGCGTATGAGTCTTTATACGGTGAATAT
GTGTCTGGAGCTCTGAGGTTCATCAGAAAATTAATTCTAGCTGTTTCCCAAGTTTGATAT
CAGGAATATAGGGTAGGTTTGTATTGGGTGTTTGTGTTTATGTGCTTTTATCCAATTTTT
ATGATTGGGCAACATGAAAACCAATTTATATATATATACATATATATATAATATAAAAAG
ATGAATAATGTTAATCATTGTCCAATTATAAAAATATGTGCTGAGGCAAGAAACACACAC
ACACACACACACATATATATTTATAAAAACAATGACATCCAAAGAGACATAAAGGGTGTC
TGTCATTTCTTTGGCTAATGATGATATAAACAGAAGAATTACAGATTATGTTAAAATTTT
TGATCAGGTGCAAGTTCAAAATTGTTCATTTTTTAAGAGAAAATGGAATAAGTATCCTCC
AAATACTGATTGTATAAGTGACTAATAATAGGTGAAACGCAAAGATCAATAGTGAGAATG
TCTCTCTTTTTGTGCTCATCTCTGACCCTATATCCTTAGAATGGATGATGTGTTCTGATT
TGAGGATTCCTCCCATGGTTATGTGCTCTGCTGGGACCATGTCCAGGAACAAGCATATAG
ACCCAATGTGAGTAATATTCAAATTTCTTGTTTTTCTTTGGGTGGTTTACTTTGGAGGAC
TAAATGCATATAAATAAGTACATAATGTAATCGAAGATGGCCAGTTCTGTCTAGTAATAG
AGAACTGATATGAAGCATTATATTGGTAATGCACATGTAAAAACTAAGGGTGATTAATGA
AACATACCTCAATGTTAGAATGAGTCTAGATATAGGTTAGGAATATCAAGTTTTTCTTTG
TAGAGTTTTGTGAATCATAGTATTTAAAATGATTATTAGCAAATTAATTAATCAGACAAA
GTAGAAATGGAAAAAAAGGGGGTCAGTCCTGGATTGATGATGACTACTGGCACATATGAG
TCATAGACAATGAATATGTATCTGGTCTTTTGAAAAAAATAAGTGGTCTGTTCCTTTAAA
TGATTCTATATGCCAGGAATATAGAAGGAAGTATTTTTAGTTTTCGTGTTTATGCATTTT
CATTTTATATTTATAATTATATCAGTAAAAGAATCAATAAATACATAAAGATTAGTAAAA
AATTCATACTTTATAATTGTCCAATTATAAAAATATGTGGTTGGACAAGAAATACTATTA
GTATATATTGAGACTGGTAAAGTCCAAAGACAAATTTGGCATACCTATGACTTCTGACTA
ATGATGATACAGGCAGTGTAAATTATTGACCATATTCAAGTTCTGCATCAGTGGCCAGGT
TAAAATTGTTCATTTTCTTAATGGAAATGAAATAAATATGCTCCAAATTAATGAATGCAT
AGACAAATAACTAAATGAAAACTAAAAAGCAAGGATCAATGTCAAGAAGGGCTCCTTTTG
TTGTCATAGTTTTCCTTGTTTATAAACTATATGGTTCCATCTCTCTGTTAGAAGCCCGAA
GACCAAGTGAGTAATAGTCAAAGTTCTTGTCCTATCTTGGGTGGTTTGTTTGTAAGTTTA
CATTGCACTAACAAAAAATATGAAATGTAATTATGAAGGTCATGTGTAGCTAAAAGATAA
ATGTGGAATGAATATGAAGTGTTATAAATGANNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNN
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved