Otolemur_garnettii Locus Mono:144:SNORD62
snOPY snoRNA Orthological Gene Database
Otolemur_garnettii Mono:144:SNORD62
Otolemur_garnettii
Mono:144:SNORD62
scaffold_114855
SNORD62
1001..1085
2085
CAAAGTCTCACTTTTTACCCTGGGTAGAGTGCCGTGGTGTCTTAGCTCAGAGCAACCTC
CAACTCTTGGGCTTAAGTGATCCTCTTAGCTCACAGCAACCTCCAACTCTTGGGCTTAAG
CCATCCTCTTGCCTCTCAATCTCCCAAGTAGCTAGGGCTACAGGTGCCCGCCAAAATGCC
TAGTTTTTGTTTGTTTGTTTGTTTTGTTTTAGAGACTGGGTCTTGGTCTTGCTCAGGCTG
TTCTTGAACTCCTCAGCTCAAGCAATCACCCGCATCAGAAAAAAAAAGATACTGTAACTT
TTTTTCTGTTCACCATATTTCCTATAATGAGCATGTCTTGCATTGATAATCAGAAACATG
TTTTGCATTGATAATCAGAATCTTGCTCAGGCTGGTCTTGAACTCCTCAGCTCAAGCAAT
CACCCGCATCAGGTGCTAGGATTACAGACATGATTAATTCTCCCAGAGTGCTAGGATTAC
AGACATGAGCCCCTGTGCCTAGCCTTTATCATTGTTTTAAGGAGATTTTTACTCTTCTTT
TTGATCTTTAAAATAGCATTTATTGCTTTTTATTGTAAAAGTCTTATAATGAAGAATGTT
TTAAGAGAAAGCAGTGTGGGACGAAGGGAAGAGAGGGCATATCTTGGTTTGGAGTTCATT
CTTACTGTTTACTATTTATGTGAAGTTGTGGAACTCTTCCAACTTCTCTAGACCTCAAAT
TCCTTTTTTTTTTCTTTTGAGGCAGGGTCTCACTCTATCACCCTGTGAGTGCAATGGCTT
CAGCCTAGCTGATAGTGATCCTCCTGCCTCAGCCTCCAAGTAGTTGGGACTATAGATGTG
CACCAACATGCCTGGCTTGCTTTTTGTAGAGACGGGGGTTCTCCCTCTTGCTCAGGCTAG
TCTCGAACTCCTGGCCTCAAGTGATCCTTCCACTTTGGACTCCCAGATGCTAGGATTACA
GGTGTGAGCCACCCCACTTGGCTGCCAAATTCCTTTTTTGGTGTCAGTGAGGTATCTCCA
GTAGATCGTTCTGATCCTCACTGTGGTCTCAGTAGGAGGGAGATGAAGACAACAGTGCCT
GAAAAACCAATGTAGCCCTCTGGCCTACCTTTCCTACCTAACCATGCACCAACGCAGCCC
TCAGTGTCTGGGGCAGTTGGTGCATGGTTAGGTAGGTAAGGTAGGCCAGAATCTGCTTCT
GTCCTCCTGGGCCTGATGCCACAGCCTCCCCAGTTCCCTGATGTATGTCCCAGGTATGTT
GTGAGCGGTCATGTACTGCAAAAGCTCGAGGAACTGAGCAGCGCCTGTGCACACACACAC
CCTCACTGAGTCCCCTTGGGAAGTGTAGATATGCAGAATGGGTCTCTGAAAGGATATTCA
GAAATAGACTAAAATAAAATTCTTTTTTTGGAAAAAGGAGATGATAATAGCTACATCATA
AGATGTTTACGGGAGTCATTATAATAGCACATAAAGGAACTTGGGCCATCAGTATTGCTC
TCCTATCTCCATTCTATGACTTATAAGCTAGGAGTAAGAATAGAGATGTTCCCTGCCTAT
CAGGATTTCTGTAAGTTAATGGGAAAAATAACACATAAAACATATAGGAATCAACTGGAG
AGAAAACAAAACACAAATGTAGAGAGTATAACTAAGACAGGGCGATTCATGGTTGTGGGG
ACCACTGGAAACTTGCTTTTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved