Otolemur_garnettii Locus Mono:442:SNORA28
snOPY snoRNA Orthological Gene Database
Otolemur_garnettii Mono:442:SNORA28
Otolemur_garnettii
Mono:442:SNORA28
GeneScaffold_507
SNORA28
1001..1117
2117
TGGGCATGGTTGTACTGGACAAATTAACAAGGTAGTTGTATGCTTACATATACCATACA
TATTTATAATTTATAAGCTGAATTAATCATTTACTCTGTACCAGATTCTATTCTTGGCAT
TCGACATGTCTTACCTCATTTAATCCTCAACAGAACCCTATATGGTAGAAAGTGCTATTA
TCCCTTCTTTATAGATGATAAAACTGAGGCCCAGAGAAATTAGGTGACTTGCCCAAGGTC
CCACAGCTTCATGCCCTTACTCACACTTGTAGGTACTCAATAAATGTTTGTCAAATAAAT
ATATGATTAAAATATTGCTTGTGTTCTACAGGAGCCCCCAGATCTTTTTCTATCCCAGTA
GCCCTTTGGCTAAGTCATCCCTACCTGGGACCCTGGGGGGTTAGCGGCTCATTCAGGGGG
CGGTTTGAGGGAGCCTCATGATGTCTGGACCCTCCGGACAAATCCTGGACACTGTGGTAG
AACCTTGAAGACATTAGAGTATAAAGGAAGGGGACATGGGTCAGCAGTCTGTAAGGACCT
TGCAGCTGGGCCTGTCTCCCCATCCCCCCACCCACCCCAGGCTGAGCTCACTGTCGGCGG
TTGGTACTCATATCGACACAGACTGTGGGGACCTTGGAGGAACAATGCTGGTGGAACTTG
TAGCCACAGGTTTGACAGCGGAAGCCATTGAACAGAAACTTAAGGCAGAAGTCACAGAAT
GCCAGGCTGAAGAAGGTCTTCCGTACCTGCTGCCACAGAACAAGGAAGGTTAAGGGCTGA
TCAAGACCCTTTCTCCACACACAGTGTGCCCCACCTGTCTACCCTGCACTCACAAAATTG
TGCATGGTCAGTGGGACATCTTCAAGGACCTCGACAATAAGTTCCTCACCATCCAGGGGG
GCAATGGCCGTGTCCCAGGCAGTGACTGTCTTTCGCCTGCAGAGGGCATTGAAGGGAATG
AGTAGAAGGATGGACAGAGGCCATGGAGAAACAGAAAACATCCAAAAGTCCCTCCGACAA
AAGTGTCCGACACAATTTGAGCTTGCTATAGCAAGAAAGTCTAACCTATTCTCGTGTTCT
CCCTTTGTGGGATAAGCCATTATATAGACTTTAACACTGGAAAAAAAAAAGTCCCTCTGA
GCCTGCCATCCATGGAGTAATATTTGGCATGTTTGTTTATTTATTTTTTTGAGATGGAGT
CTCTCTATGTCACCCTCAGTAAAGTGCCATGGTGTCATAGCTCACAGCAGCCTCAAACTT
ATGGGCTTAAGCGATTCTCTTGCCTCAGCCTCCCAAGTAGCTGGGACTACAGGCACCTGC
TACAGTGCCCGGCTATTTTTATGTTGCAGTTGTCATAGTTGTGTGGCAGGCCTGGGCTGG
GTTTGAACCCGCCGGCCTCTGTGTATGTGGCCAGTGCTGTAACCACTGTGCTATGGGCAC
CAAGCCAATATTTGGCATGTTTAATTCTCATTACAGCAACTTAAGGAATTAGTCACTATC
CTTGCCGCCGTTTTACAGATAGGAAAACAGGTTCAGAGAGATTAAGTGACTTGTCCAAGG
CCACAAGGGTTAACGAATGGCAAGACAGAGTGAAGAGGCCATGCTCTCAACCACAAGGTA
AGAAGTGAAGGAAGCCAAACAACTAAGTGTGACAAGTGCTAAGTGAGCTCAGAAAAGGAG
GCTGAGGAGGCACTGAAAGAACAAATAAAACATAATGTGTGAACTGGGCTCGGTGCTCGT
TGCTCAGTGGTTAGGGCGCTGGCCACATACATGGGGACTGGCAGATTCAAACCCAGCCTG
GGCCTGCTAAACAATGACAACTACTATAGCCCCAGCTACTTAGGAGGCTGAGGCAAAAGA
ATCACTTAAGCCCAAGAGTTTGAGGTTGCTGTGAGGTGTGATGCCACAGCACTCTACCAA
GGGTGACACAGTGAGACTCTGTCTCAAAAAAATAATAATGTGTGAATTGCAGAAAAAATT
TAGGAACCCCAGAATGGAGGAATAAATGGAAGGGTACCAAGGCCCAACTCAGGAGACAGA
GAATGGGGAAACTGAAGAAGGAGAAGTGATGAATTAATGAAATAGTGAAAGAACAAAATA
GATGATCTCTGGAAGTGA
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved