Otolemur_garnettii Locus Mono:374:SNORA42
snOPY snoRNA Orthological Gene Database
Otolemur_garnettii Mono:374:SNORA42
Otolemur_garnettii
Mono:374:SNORA42
GeneScaffold_4822
SNORA42
1001..1131
2131
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGAAATTAGGGGAAAAAG
CAAAATAACCCAAAGCAAGCAGAAGGAAGTCAATTATGAATAGAAATCAATAAATAAAAA
GAGGAACATCAATGAAATAAAAAGTTGATTATTCAAAAGAAAGGAACAAATAAATAAACT
GACAAATCTCTACTAAAGTGGAAAAAAACAAAGAGAGAAGAGTATAAATGACCAATAGCA
AGAATGAAATAGGGCCTCTCATAGTGCCCCATGCCAGAGCAAACTGTGGCCCTGAACCAT
TGCCTGGTCTCTGTGTCCATAGGCTGCTGGCACTGAAGTGGGTTGCACAGAGGAAAAAAA
AAAGAATGAAATAGGGGCTATTAGTACAGAGCCGGCAGTCATTCAAAGATACTAAGGAAA
TACTGTAAACAACTTCATGTTCATAAATCCAACAACTTAGAAGAAATGAACTAATTCCTC
ATAAACTATAAACTACCAATACTCAACCAAGATGAAAAAAGCCAAATATACCTATACATA
CAAAAAAATTGAATTTATAATTAACAACCTCCCCAAAAAGAAATCTCCAGGCCCAGGTAG
TTTCGCTGTTGATATCTACCATTCAAAAAATTAATAGCATTTTCCATGTTAACCAGTTTG
ATGAAAATATTTCAAATTGTATATAAAACCAGCACATTGTACCCCATGACTGCATTAATG
TACACAGCTATGATTTAATATAAATAAATAATAAATTTTTAAAAATTAATAGCATTTTTA
CACAATCTTTTCCAGAAAATACTAGAGGACAAAACAGTTCTCAACCCATTTTATAAGGCT
GGTATTACCATAACACCAAATCAGACAAAGATAGTACAAAAATAGAAAACTACAGATAAT
CTCACTCATTAATTTAAGACATAAAAATCCTCAACAAAATATTAGCAAACTGAATCCAAC
TATGTATAAAATGAATCACATACCATGACCAAATGTAATTAAAGGCAAGACTGGTACAAC
ATCAAAAATCTACATAGCAACAATCTAAAGAAGGAAACACTATCACATTAATTATAATAG
AACAGAAAAAGCATTTGACAATATCTAACACCTAATTCATGATTTTAAAAGAAACTCTCA
CCAAGTTAGGTAGAAAATGACCTCAACTTGATAAAAAAGCTTACAGTTAAGAGCATACTT
AGCTCTTAAAACTGAGAAGAACACCAAGGACTAATAACTGATTTTGACAAGGTTGCAGAA
TATAAAAACCATCACATTTCTATATTCTAACAGTGAACAAGCAGCAACAATTTTTCTCTT
TTAAAATATATATGGTTTGGCACATAAAGACC
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved