Otolemur_garnettii Locus Mono:313:SNORA25
snOPY snoRNA Orthological Gene Database
Otolemur_garnettii Mono:313:SNORA25
Otolemur_garnettii
Mono:313:SNORA25
GeneScaffold_4941
SNORA25
1001..1129
1399
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
TAATGTTATTTTTGCTGAACCACTTCAGATTAAGTGCAAGAATCATAATCCTTACCCATA
AATACATCTGTAAGTATCTCCTGAGAACCAGATATTCTCATAATCATAGCAGTAAATTAC
AAAATTCAGAAGTTTTAACATTGATACAATACTTCAGCTAATGTACACTGCATATTCAAT
AAGTAAGTATTTCTAATAGTCGGGTTTTAGGCACTGTAGTAAAGAATCTCAAGTAGTATG
ACAAAGAGTTTGGGGAATAGAAGAGGGCCTAATTGCTGCTTCTTAGAATTATAGACAATT
AATCTCCGAAGTCTGTCTTGCTACAGAGTTCAGACAAAGGGGGGGGGTGTCAATATTTAC
CAGAATAGGAGGAGAAAATTCTAAAGAAAAATTGTGATTAAGTTGGAGATAGTGAAAGAT
GATTGAGAATAAATATAAATTCTAATCAAAATTGGAAAAATTGGTCACTTCAAAGTGGGC
TCATGCAGTTGTGAAACTAAGAGCTCTTAACACTGTGATGAAATATGGATATTCTCTGTA
GAACACTATAACACTAAATTAGTGTTATGTTTTCCTAAGAAGAAGTATAAGACTTAGCCA
CAAAATAAATAAATAAAAAGAAAAAGAAAAACAATTCTGGAAACAAACTTCTTAAAAACG
AATATGGTGATGATTGCATCATGGTATAAACTAAAACTGAGCAAACTGTACACTTAACAA
TGGGCAAATTTTACAAGATGTAAATTAATTATACTACAATAAAGCTGTTTTTTAAAAAGA
TAAAAGAAAAAAGTGAATATTTTATTCAGGTGACCAAGGGAATACATAGCAGATCATAAG
TGTACACATATTTTTCAACA
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved