Otolemur_garnettii Locus Mono:317:SNORA62
snOPY snoRNA Orthological Gene Database
Otolemur_garnettii Mono:317:SNORA62
Otolemur_garnettii
Mono:317:SNORA62
GeneScaffold_5301
SNORA62
1001..1165
2165
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTTCTTTCATG
GCAATATCTCACAACTCTTCCAGCCTCTGCCCACTACCTGGTTCCAAGGCTGCTTCCAAA
GTTTTAGTTGTTTGTTTTAGCAGCACCCCACTTCTCAGTACCAATTTCTATCTTAGTCCA
TTCAAGCCACTAAACAAAATACCTGAGACTGGGCAATTTATAAATAATAGAAATTTTTTT
CTAGGCTTGGTGCCTGTAGCTCAGTGAGTAGGGCGCTGGCCACATACACCAAAAGTGGTA
GGTTTGAGGCCAGCCTGGGCCTGCTAAAACAACAATGTCAATTGCAACCAAAAAATAGCT
GGGCGTGTGGCAGACACCTGTAGTCTCAGCTACTCGGGAGGCTGAGACAAGAGAATCACT
TAAGCCCAAAAGTTGGATGTTGCTGTGAGCTGTGATGCCATCGCACTCCACTGAGGGCAA
CACAGTGAGACTCTGTCTCAAAAAAAAAGAATAATAATAATAAGGTGCATTGTTAGAGCT
TGGAGTTTAGGCCACTGATTGGCTGGTGAACTCACAAGTGTAGGCAAGTTTTTCACTAAC
TTGAAAGTGAGAGGCAAGTTTTTCACTAACAGCACAAGGGTCTCTGGTCCAATGAGTGGA
GTTTGATAGTAATCCCTGCTACAAGTATAATGTTAATGCATAACAACATTGAGAATGTTG
ACGAAAACTTTAAAAGTGGTCTGTTTTCTCCTGCCTTTCTCTGTATTTCTCGCTCTGCCC
TGGCATTACTTGGCTTTTCTGTTTTCAGACTAACTTGATGAATCCTGCTATAAGATTGTT
AAAAGGGGGCTCACTCAGTAGGTCTGATGTGGTGGATGCTGGCCTGGGAAGTTCTCTGCA
TGCTTGGCACCATCTCCTGTGAACACCCGTGGGAGGTCATGCCAGATCTCTATTTCTACA
GAGATCGTGAGGAGATTGAAAAGGAAGAGCAGACTGCTGCTGAGAAAACTGTGACCAAGG
AGGAATTTCAGGGTGAATGGACTGCTCCAGCTCCTGAGTTTACTGCTACTCAACCAGAGG
TTGCAGACTGGTCAGAAGGCCTGCAGGTGCCTTCTGTGCCTATTCAGCAGGTCCACACTG
AAGACTGGAGAGCCCAGCCTGCCACTGAAGACTGGTCTGCAGCTCCCACTGCTCAGGCCA
CTGAATGGGTAGGAACAACCACTGAGTGGTCTTCCACAAGCTCTTAAACAAGATGGAAAT
AAAGTAGGAGGAAAATAAACATTAGTTTAAAAAAAAGAAAGAAAGAAAGAAATTTTTTTT
CTGGAGATTGGAAAGACCAAGATTCAAGGCACCAGCAGATTCAGTGTCTGGTAAGGGCTT
GCCCTCTGTTTCTAAGATGACACCTTTTTGTTGTGTCCTCACATGACAGAAGGGCAAAAA
GGGACATAGTTACTCCTTCGAGCCCTTTCATGAGGACACTAAGCCCATCCATGAAGGTAG
AAACCTCATTGCCTAATCATGTTCCAAAGGCCTCACCTCTTAATACCATCACCTTGAGAT
TTAAGTTCCAATGTATGAATGTTGAAGGAACACACACATTCAAACCATAATAAACATATA
TTTTTTTCTGTTTGAGAAGTAGAAGGCTGAGAAGGCTACAAAGTGAAGTAAGCCCCAGAG
ATTTTA
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved