Otolemur_garnettii Locus Mono:501:SNORA21
snOPY snoRNA Orthological Gene Database
Otolemur_garnettii Mono:501:SNORA21
Otolemur_garnettii
Mono:501:SNORA21
GeneScaffold_1991
SNORA21
1001..1136
2136
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTTTTCCATGTC
TTCTCCTAGGGTTTTTATTGCTTCACTGTCTTAAATTTAAATCTTTTATTCATCATGACT
CAATTTTTGTAAGTGGTGAAATGTACAGATCCAGTTTTAGTTTTCCCAGCACCATTTATT
GAATAGGGATTCCTTTCTCCAATGTATGCTTTTGTTTGGTTTATCAATGAAGATCAGATG
GCAATAATGTATATTTCTTGGCTGTTTATGTTACTTAAGTGAATTGCCAATTCATTCCTT
TCCTCAATTATTGTGTTAATCATTTTCTCATTGTCTTATAGGAACTCCCTGCAATTAGGG
ATGGTAACCTCTTATTACTTTTATACACATAGAAGGAGTCTTTTTGGATATCAAGGAAAG
GAAGCCACTGAAGCTAGCTCCATAAAACTTGGGGAGGGGGTATAGACACTAAAATCATAT
AGCAGGGAATCACAAACATTCAAGGATATGGATTTGTGACTTTATTTAGTGAGATATTCC
TACTACCTGGAACAAAGTCTGGCATATAGTAAGCATTCTCTAAACACTCAGTGAATGAAT
GAAAGAATGAGAGATCTATCACTCCAAAACCTATTCTTTCCTCCCTTTTTAAAGCACTCA
GTGGGCCTCTTGCTAATGACCCATTGAGCTGTCAAGAAAGGGCAGATTAAAAGCACCACT
TTGGGGTGAAGTGGCAGTATTTTGTGTTGTTTTACTTTATTTGGTGGTGTGACAAGGTGA
AACGCTTGAGCATTGAGTTGAGGGAGAGGCTCTGGAAGTGTTCCCAAAATGTTATACTGG
TGACACTGCCTAATTGACTCTCAAAAAAAAAAAAAAATTGACGTTTGTTTAAATCCTTGT
AAAGAATAAAATGAAAACCAAAACCTGTTCTTTTTATTATTATTTCTAAACAACTATCTG
GGGCTTTGTGATATATCTTTCATTCATAGTAATTGGCTGTACTTTTTAGTCAGTTGTCAA
ATGTTTATGTTTATCAAAGCTCCACTTGTAGATCCAAAGAAGGGACATTTTGTTGGCCTT
TTTGCCAAAACTGAAAGTCCCAGTGCTTATCAAAGTTTTATATGACTTTTAGCTCCTCTT
TGCATATCTGGGTATTGGCTTGAGACGCATCTGATTATTCAGATCATGAAGATATCTTAT
AGGAAATGGATGGCAACATAGCACTACTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNTTCATCAACCTAGTTAACATAGCCTTCATGTCATTTTCTTAG
TTATTGTGTTAAGACATTTATATTCTACATTTAGCAAAGTTAATTCTTCTATGTTCCTTG
AACATGATAGGTAGAAAACTGATGACTTTTCTGGTCACTCATGTAAAAAAAAGTCAACTA
GCCAATTAGACAGCTTTATATCAGTAATTAATATGTC
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved