Otolemur_garnettii Locus Poly:11:SNORD116
snOPY snoRNA Orthological Gene Database
Otolemur_garnettii Poly:11:SNORD116
Otolemur_garnettii
Poly:11:SNORD116
scaffold_82685
SNORD116, SNORD116, SNORD116, SNORD116, SNORD116
1001..1095, 2559..2653, 4184..4278, 6667..6760, 8148..8239
9036
CCCACAGAGTCGCTCACAGTGGGTGTATGCTTTGAGGAGCAGCTTGTTTGGTGGGAGAG
TCAGCCACGTCTCCTGTCCACACGGGACTGAGCTCAGAGATGATGGTGTGCACTTGGTAG
CCCTTGGTGTCCAAGAGTTATCCTTTCCTGGTGTCAGGTATAGAAGATGGGCAGCGTGAT
GGCTCCTTGAGGAGATGGGGAGCACAGGGGCACTCTAGGGTACCAGACCCATAGCGACCC
CCTCGCGCAGACCAGCGGAGAGGAACACAGACAAACACGAGCACACCTTGGCTGGGGACA
CGATATTTTCCATGGTTGTCCATATTGTTACTTGGCTTAGGGGAATTCACGGAGAACAGA
AGACAGGAACCCCAAAACAGGATGTCAATGAGAATGAAGGGAAGTTACTGTGCTGCCAGC
GATGGCAGTGCAGCGACCACCTGTGTCCTTGAATCCCTTTCTGAAACGTGCATTTGATTT
GTGTTCACTTCTCAGGGGCCGTCGTCTTGAGAGACATGCCATTGACTGGCGAGGACGAGG
TACATCCCTTCTTAGGACAGAGCTGCCTGGAATTCTGGAATCACTGTGGCCAAGGCTGGC
AGATGGCTCCGGAGGGTAAGCATTTCCTGGTTTGGAGGGTTCACACTGTGTTTCGGACTC
TGTAACTCCTCCCGGGAATGGCTTCTCCGTGTTGTGGCTCTGACATCTCTAGGGTGCAAA
AGACCTTGGTGGGCACTAGCGTTCCCACTGCTGAGTCCCGGGTGATAAAATTTCCAGTGT
CTTGTCACGTGCGTGCTTGGATCGATGATGAGTTCCCCATCAAAACATTCCTTGGAAAAG
CTGAACAAAATGAGTGAAACTCACTACCGTCTCGCTCATCGGAACTGAGGTCCAGCGCGT
TGCCTGCACCAGGGCCTTTAGGAGTGAGGCACAATGTGCACTCTTTCACATTCCTGCCAT
GCCCCCCGCCCCCCCGGCACACATGATGGGAGTTCTCCCTGGGTAGGGGCATCAGAAGGA
GGGCCGAGTGTAATGTGCCTGGGTAGGAGACTTGTGAGTGCAGTGGTGGCTCTATTGATG
GGAGCGAGCCATCCTTTCCAGCACAGGGATACCAGGCGAAGGGGGATGGTTTGCCTCCTG
GGCTTGCCAGGCCAGCAGGCAGGATATGTGTGTGTGCAGGAAGAGAGCTGGGCCTCCAAT
ATCTAGGCACCAACAGATAGGCCAGACATTCAGGCTGACCGTGACCTCTGTCTTCTCCTT
TGCTGAGATAAAGCCATGGTCGGTTTTGATAAGGGGGAGAGATGTGGAAAAGCTCTAAGG
TGTGGATTTCACCCCACCATTAGGCCCTCAACTTAGGGCGCAGCAAATTGGGAGTGGGGG
GGGGAGGGCGGGTCTCCCCGCACTCTTATTCACATCACCACGGACATAGCGGCTCAGATA
GTGGCGTTGCCCGTTTAGGTTGGTGGCATTTGGTTTTGTGCTACTCGTGCCTCCCTTGCT
AGGGGTCCCAAACCAGCACATCCTCATTGTCGTCAGACTCCAGACGTCAGGGAAATCGTG
ATCGGCCCTAGATTATGCCCACAGTGCTTGTATGCTTTCAGGAGAAGGCTTGTTTGGTGG
GAGAGTCAACCCCGTCCACGAGGGACTGACCGCAGAAATGATGGTGTTTACGTGATAGCT
CTTGGGGTCCAAGAGTTACCCTTTCCGCGTGTCGGGTATTGAAGATGGGCAGCGTGAGTG
CTCCTTCAGGAGATGGGGAACAGGCCCGGCGCCCTAGGGTGCCAGGCCCATAGCGACCCA
CTCACTCAGAGCAGCACAGAGGAAGACGCAGAACACGACGAGCACACCCCAGCTGGAGAC
GTGCTGTGTCCCATGGGTGTTCACATGTTTACTTGGCTTAGGGGAATTCTTATGGAATAG
ATAAGGCAGGAACCGCAAACAGGGTGTAAATGGGAAGGCTGTGAAGTTAGTGTGCTTGCA
GTGTTGGCAGTACAGCTGCCACCTGTGTCCTTGAATCTTTTTCTGAAAGGTGCATTTGAT
GTGTGTCCACTTCCCAGGGGCAGTCACCTTGAGAGACATGCCATTGGCCGGCGAGGACGA
GGTGCATTTTCTCTTAAGTCGGAGTTGCCTGGATTCCTGGAATCGTTGTGGTCGAGGCTG
GCAGTTGGATCCGTAGGGTAAGCAGTTCCTGGTGTGGAGGTCTGACACTGTGTTTTGGAT
TTTGTATGTACTCCTGGGAATGACTGCTCCGTATCATGGCTCTGACTTCTCCAGGGTGCG
CAAGACCTTGGTGGTCACCAGCTCTTCCATTGTCATGTCCCACTTGGTAAAATTGCCAGT
GCTTTGTAATGTGCTTGTATCAATCATGAGTCCCCTTTCAAAACATTCCTTGGAAAAGCT
GAACAAAATGAGTGAAACTCATTACTGTCTCACTTATCTGATATTAGGTCCAGCAGTTGC
CTGAACCAGGACATTTAGCAGTGAGGCACAGTGTACACTATTTCACATTCCTGAAATTTC
TCCCTGGCATGCCCAATGTAAGTTCTCCATGGGTCGTGGCATTAGGAAGATAGTCGTACA
GAATGTTCCTAGACAGGAGATTTTTGATTCGTATGGTCGTTGTACTGATGGCAGGGTGAC
ATCATTTTCAACACAAGGATTACTGGAAAAAGTGGATGGATGTCCAAGGCTTTTGGGCTT
GCTAGGCAGGCAGGTAGGCAAGATCATTGTCTGCAGGAAGAGGACTGGGCCTCCAATATC
TAGGCCACTAAAAGATAGGCCAGGCATTCAGGCTGACCGTGACCTTGCTCTTCTCCTTTG
CCGAGATGGATGAAAGTATTTCATTTGTATATAGAAACAGTACACTGTACTCCATGATAG
CATTTATGTACACTGCTATGATTTAATAAAAAAAAAAAGATATGGTCAGTGTTGATAAGG
GGGAGGGATGTAGAAAAGCCTTAAGCTACAGAGTTCTCCCATCATTAGGCCTTCAACTTA
GCACACAACAAATAGGGGAGTCTGTCTTCCCCCACTCTCATTCATATCGCCATGGACCTA
TTATCTCAGATAATCGCATTGTCTGGTGTTGTTGGTGGACTTTGGTTTTGTCCCAGGCAT
GCCTCCTTTGCTAAGGGTCTTGAACCATGATGTACTCATTTTCGTCAGACATCAGGGGAA
TCAAAATGGGCCTTAGATTGTTCCCTCAGTGTGTGTATGCTTTCAGAAGAAGCCTTGGTT
GGTGGGAGAATTAACCCTGCCTTTTGTCCACAGGGACTGAACTCAGAGGGGATGGTGTTT
GCATTGTAGGTTTTTGTGTCCAAGAGTTATCCTTTCTTGGTGTCAGGTATAGAAGATGGG
CAACTTGACTGCTTCTTTAGGTGATGGGGAACACACAAGTGCCCTAGGGTGCCAGGCCTA
TAGCCACCCACTCACACAGACCAGCACAGAGGAACACAAAGAAACATGAGCACGCTTCTC
CCGCAGACATGACATTTTCTGTGGTTGTCCATATTGTTACTTAGCTTAGGGGAATTCGTG
GAGAAGAGAAGGCAGGAACCAGAAAATAGGATATCAATGAGAAGGCTGGGAAGTTACTAT
GCTTGCAGTGATGGCAATGCAGTGGCCACCTATGCCCTTGAATCCCTTTCTGAAACGTGC
ATTTTGATTTGTGTCCACTTCTCAGGGGCAGTTGCCTTGAGAGAAATGTCATTGGTGGGC
AAGGACAATGTACATTCCTTAGGACAGAGTTGCCTGGACTCATGGAATTGCTGTGGCCGA
GGCTAGCATATTGCTCTGGAGGGTAAGCATTTCCTGGGTAGGAGGGCTGATGCAGTGTTT
CAAACTTTGTACCTCCTCCCGGGACCAGCTTCTCATTTGGATGGCTCTGGCTTCTCCAGG
GTGCGGAAGACCTTGGTGGTCACTGGCTCTCCCACTGCTTAGTCCCAGGAGGTAAAATTT
CCAGTGTCTTGTAATGTGCTTGGATCGATTATGAGTCCTGCATCAAAGTATTACTTGGAA
AAGCTGAATAAAATGAGTGAAACTCACTACTGTCTCACTTATCAGAACTGAGGTCCAGCA
ATTTGCATGAACCAGGGTCTTTCAGAGTGAGGCACAACATGCATTGTTTCACATTCCTGG
CATGCCTTTAGGGCATTCACAATGGTAGTTCTCCCTGGGTACGGGCATCAGGAAGCGGGC
TGCACACAATCTACCTGGGTGGGAGATTTCTGAGTGCAACTGTGGTCATATTGATGGCAG
GCTGCCATCATTTCCAGGATCTAGGCAAAGTTGGACTTGCAGGCCTCCTGTGGTTGGTGG
CCCAACAGGCAGGATGTGTGTGTCTAGGAAGAGGACTGTGCCTCCAATATCCAGGACTAA
TGATAGACCTTGTTTTCAGGGTGACCATGACCTTGCTGTTCTGCTTTGCTGGGTAAGACC
TGGGTTAGTGTTGATGACTGACTGGGAGGTATATAGAAAAGGCTGAATTGGCTGAGGTTC
CCCCACTTTGGGCCCTCACCTTAGCAGATCAGCAAAGCAGGGTGGGCTGTCTTTCCACAC
TCTTACACTGCCACACTCCACATGGCTGGAGGCGAGCTGAAAAAGGTCCTCATGGTACTG
GCAGGGAGGTATCCCAGAGAGAAGTGATATGTGATATACACGCTTGGACATCCACAACAG
GGTGTGTGGAAGTGGCTTCCCATATATTCCTGGGCAGGTCTCTGGTTGCAAGTGGAATTG
TCAAGTGTGGTGGAGATTGCCAGCAAAGTCATCTAAGGGTGGTCCCTGTGACCACTCCTA
TTGCAGGGTCTTCAGGCTGGTCCCCAGGTGACCTAGCCTTTTCCAGCTGACTATGTTTCC
ATGGTTGTGTTCCTGGTAGGGGAACATGTCCCTTAGGATCCCACCAGAGTATGTTTGTTG
TTGCAGCTTTTCTTATCCAATATTCACATGGATACTTCTTCCCTCACCCCCGATGCTTGC
TTCTTGAAAGTGTCAGAAGGAAATTTCCACACCTGGGCATGGTCTCCTGTGATCTGGCTC
CACATTCCCATTTGCCTTGGTGAAGGGTAGATTTGTATGCAGCTGTAGGTGTACTGCATT
GGAGCCATTGACTTGGGACAGACTGATGACTCTGGGTTCATTATTCCATTCCCTGTGTGG
TTGGTCAGAAGCCTGTTTATTCCCTTCAGAAGTGGACAGGGGTAGCATGAGAGGATTGGA
TTGAGAGGTTACCGGGCTGGCAGTTGAAGGAGAAAAGGTGGGTGTGGTTTGTGATCGATC
GTGGTCCTTGTAGGTGACTGGGTGACTAGGAATTGATGGGTCCACAGCGAGTGTTATGGT
TTTTCAGGGCCCTGCATTGGAGGCATGAGGATGGGGGTTCGGTCAAGTTAGCTGCATGAT
GGGCCCACTGAAGTAGTGGTGACTTTGGTGAAGCTCCCTCAGGGTGGTTTGTGCAAGGGT
ACTGGTTGACTATGTGCATACCTCTTGGGTTCTGCTCGATCATTCAATGGGCAAAACACC
CATGACTCTCGGGTGTTGTTGTCACTCTGGGAAATGATTGTTGGAGTCCCCAAAGAGAGG
GCTTCGATGTGGGAAGGCAGCAATAGGCCACCTGTGTGAGTCTGCCTATGCCCATTTTGC
ATGAATTCAGTTTATGTCCATGCTCAGATGGTGACTGTGTCCAGTGATGTTAGTGGACTT
TGGTTTTGTGCCAAGCGCGCCTCCCTGGCTGAGGGTCCTGAGCCAGTACATCCTCATTGT
CATCAGATTCCAGGCGTCTTGGGAACCTGAGGGGCTGTAGTTGTGCCCACAGTCCATGTA
TGCTTTCAGGATCAGCCAGTGGGCAGCATGACTGCTCCTTCAGGAGATGAGGAACACAGG
AGCACCCTATGGTTCCAGATGCATAGTGATCCACACATGCAGAGTAGCACAGAGAAACAC
ACAGAAACATGAGCACATCTCGGATTGGAGACCCGACATATCCCATGGGTGTTGATATCA
TTACTTATTTTAGGGGAATTCATGGAGAAGAGAAGGCAGAAACTGCAAAACAGGATGTCA
ATGAGAAGACAGGGACGTTACTCCACTGGCAAGGATGACAGTGCAGTGGCCACCTCTGTG
TTTGCATCCTTTTCTGAGGCTTGTATGCAATTTGTGTCCACTTCTCAGGGGCAGTCACCT
TGAGACATGCCATCAGTGGGGAGGATGAAGTGCATTCCTTCTTAGGACAGAAGTGCTTGG
GATCCTGGAATCTCTGTGGCCAAGGATGGCAGTTCACTCTGGAGGGTAATCATTTCCTGG
GGTGGAGGGGTAACTCTGTGTTTTGGATTTTGTAGCTCCTCCCGTGAATGGCTCCTCAGT
GGTGTGGCTCTGGTTTCTCCGGGGTGCGTAATATCTTAGTGATCACTGGCTCTCCCACTG
CCAAGTCCCATGGGGTAAAATTTCTAGCATGTTGTAACATGCTTGGATTGATGATGATTC
CCCTGTCCAAACATTCCTTGGAAAAGGTGAACAAAATGAGTGAAACTCACTACTATCTCA
CTCTTCAGAACTGAGTCCAGCACATTGCCTGAACCAGGGCTTTTCCGAGAGCGGTACAAC
ATGGACTGCTTCACATTCTTGCCATCCCTTCAGGACACTCACAGTGGGAGTTCTCTCTGA
TCAGTGGCATCAGTAACATGGCCGCACACAATGCCCTGGGTAGGAGAGTTGTGGAATTTT
AGGGCATGGTAGACATTTCAAACCAGGTCATCAAAGGGTGGTTCTTGTGACTACTTCCAT
TGCGGGGCCTCGTGCTGGTCTATGTGTGCACTCTTCTTGTCAGAGGATTCAGCCTGATTG
TCCAATGGGCAAATCACCTATGGCACTTGGGTGTAATCATGGCCTTGGGCAAGTTTTTTT
GGAGCCCCCCAAATGGAGAGCTCTTACATGTTAAGGCAGTTTCCAGCTGCCTTTTGTCTA
CAANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNGATGATGTATTGTTTTCCTATGAGTTTTAAGTTTTCTCTGTGAGGGAGGCAC
TGAAGATTAGTAAATTTGTGTGCTCCTGGGGGCAATGTAGGTTGTAGGCAGTGTAGGATC
ATGCCATTCCAGTGCTAGAGGAAATCTCCTTTTAAGGGGGATGGAAGAGGTTTTCTCTTA
AACTATTTCCATGCAACTATCCCACTGGTATTTGTCTCTTGTGATGGGACACAGGGCAAC
TTTGCTTAAGGAGTGACAAACACCTTTTACTGAGAAGTTTGTTCTTTGGCTGTGCTCTTG
AACATGGTAATGCAGTTCCCATTATCATGTGACTGAGAGCTGCAGCCCCAGTCACTCATG
TTCATGTGTCCACAGAATATGGGGAAGTTCATGAAGGTCTGCTGGTGGTTTTAATACAGG
GGCTTAATGGCTCCACCCTTTACCTCTGTGTTCCTGTCTGATGTTCTCAGGTATGCATGT
ATTCCCTCTTTAGTTTGCAGATGCTGTTGCCATGGAAGGAATCTCTGTTGTCCTCAGGGA
GAGCTTCATATCATGTTGTTCCTGGACATTGGAGGAACCTTGTGGACAATTGTGGTGTGG
CCTTCTCTGTGCTGTTGAATTTTTTTGGAAGGTAAGTGTCTCTTTTCCTAAGCAGGCCTC
TTGTATAGGTGGAAAAACTGTTCATGGATCAACTACGACTTTCATATATGCATTACTTAG
AAAGCTGAACAATATGATTAAAAACCCTATACCCTCATCCTTATCAAACTGATGCCCAGC
ACGTGTTTCCAACATGATATTATAGAAACAAGAAGAGAGAGAGAGTGAGAGAGATGTGCC
ACATTCAGCAATGCATTTGTCTGGGCATTGGCTGCATTGTTGCTAAAGCAAAGGTAAGTG
CTAGGCATTCACCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved