Otolemur_garnettii Locus Poly:2:SNORD116
snOPY snoRNA Orthological Gene Database
Otolemur_garnettii Poly:2:SNORD116
Otolemur_garnettii
Poly:2:SNORD116
scaffold_104704
SNORD116, SNORD116, SNORD116, SNORD116
1001..1091, 3542..3633, 6532..6622, 6977..7067
8067
TAGGCTTACATTAGTAATCTCAAATGTGTTTCTCAGGTCTTTGAAGGACTGTAATACCT
TTTCATTTTCATTACATGAAATGGATCACCAAAATTCTATATTCAAATTGGTTGATTATT
CCTGCCAGCTTTAATAGACAGATGATTATTTCAGTAAGTTTTTATTACTTGTTTTATTTA
TCAACTCCTGAGTGCATTCTAAGTCTTCAGCACTTACAAAATGATACATCCCTTTCTTAA
GCTACATTGATATTGGATGAACGCAGTGTTGTGGGATTTCTGAGGGCCAGGGACTAGAGG
CAAGTATCACACAAAGAAAAAAACCAAGTACAGTAGGCTCATGTTCACAGTCTCCACATA
GACCTGACTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGAAGTTCGGGG
AAAAGGTCTCCAGATAGTCCAATCAAGGTAGAGGTCAAAGGCCTCCTGCTCAGCTGTTCA
GGCATCCAGGGCTATACTGAGTGACCTTGCTGAAACTGAAAAAAGGAGTCCAAGCGTCAG
TGGTGTTTTGTGTGACAGTGTGCTGGAGATGGGTATGAAGCTCATACGTGTAAGGCCAGA
GTGCATGTTTCTGCTCACATGAACTGGGGAAGCCAAGGAAATAGAGATAGATAGGAGATA
TACCTAAAGGGTGGGTAAGCAAACGATAAGGCCCTTGGGACGGGTGCACCTGCCCCGCTT
CTGAAGTACTCATGTGTTTTCCTCTGCACCAACAGGTGACAAGTCACAGCAGACACACCA
AAGGCCAGGGTGAAACCAAGTGGCTGATGTGCACTAACGAAAAACACCAAGGAGCCCTTG
AATGCCTGAAAGGTGGTAAACTGAACAAGTGATCGTGAAAATAAGGGACTCTTTTCCCTA
CACAATAACTTTCTTAATATTCCAGGCCACAGAACGTGTGGGGATTGATGATGACTCCCA
AGAAACATTCCTTGGAAAGCTGAACAAAATGAGTGAAAACTCTATACCGTCATCCTCATC
GAACTGAGGTCTCACACGTGGCTCTACCAGAGAATAGAGAGGGAGGGATGACTTCCGCCT
GTTCACATGGGTGGTACCATGGGGTCACTCTGGGCATCTATGTGGTTCGTGATGTGGGAA
GGCACTCTTCAGTGCAGTTGGCAGCCTCCAGGTGATGAGACAGACGGGTCTTAGGAATGT
GTCCTGGTGGAGTGGGGAAGCATGTTGCCAGTCAGCAGGGATTAGTGGAGTGTCCATGTG
GCACTGTCAGAGGTAGGCAGTGGCTTCCCTCTGAGTGTATGGCACCAGAGGCAGTAGCCT
GTCTCTGAGCATACAGTGTGATTACTGTAGTGGTGCCACTTAAGCCCCTTGTGTCTCAGT
GGAAGATGGGTCATTGTGGTTGAGCATAAAGCCCAAGACCACAGCTCAGCCATCCTGTGT
CTTGGGTTTGTCCTCAGATGAGAACATTGGAGTGGCCATACTGGTTGTGCAGAATATGTT
ACTGGCAGTGATGGGTAGGTTGGGGCCAGTGAATTATGTAGTTAATGGGAGTCTTCAGAA
GGTGTCCATGTTTTGCTGGCATGGGTACCTTGATCACACAAGTTCCAGGGCAGCTATTTA
TTCTGGTGGGATGGAGGGCAGAGTGTAATATGTACAGTTTGCTACACATTGCACTCAGCT
TTCCATGGGGACAGATGAGTATCTGCTTTGGTCATTGGATGTTGCCCATATAGTGGGGCA
AGCTGTGTTGGAGCAAGGGCGCAGGGATGGAAATGTGATACCCTGTCCATGGGGGAGGTG
AAGTTCCCCAAACTGCCTTAGTTTCTTAAAGGTCCCCTGCCAGACCCTAACTACTAATTT
TCTCTTCTGGCGGCACATACAGTCTTAATGTAGGCCCAGAATTGCTCCCAGCCAAGATCA
GGTACATTGTGGGATTCTTGCTTCATTTTTCTATGAGATTTTAAGGGGATCATGTTTTGA
TTTCTGGGGCCACTGCCTTCCTAGAGCATACACAGCTCAGGGCAGTTGTGGTCCAGGAGA
GTTTACCACGTCAGGTGTACATGTGACATCTTCATGGGCATCTTCTTTCCAAAGGGGTCT
TTCACCAATTGATCCTGATACTTGTCTGTATGACAGAGCCACCACTACGTTATAGGATGG
AACTGCCAGGGATGGATCACTCCAAGGTGGTGATGGGATGCAGCGTCCAGACCCAAAGCC
AGACTGTATTCTGGGCCTTTAGGTAGAGAAGTGCAGTCTGTTTGAGTCTATGTGCCTTTT
CCATTGGTTGCTGAGTTTCCCCTGTGAGGAAGGCACTGATGGTGCAGTAGAGNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGG
ATGAGGTTTTCCTTGAATTATTTGCCATAAAGGATCTCACTTGAGGTTTTCTCTTGCAAT
GGGTCATTTTTTGTCGATGTTTGGCTCACATGTGCACCATGATCACACAAATTCCAGGGC
AGCTATTTATTCTGGCAGGATGGACAGCAGAGTAAGGAGTGACAACTACCATGTGCCAAG
AAGATTTTTCCCTGGTTATGCTCTTGAAAGTGCTCATGTAGGTCCTGTTGGCATGTGACA
AGGAGCTGCTGCCCCATACACTCCCGTTCAGATATCCGCTGGAGATGGGGAAATTTAGGA
AGCCCTGAGGGAAGTTTTAGTGCAGGGGCTTGAATGTCCCTACCCTTTGGCCCTGTGTTC
CTATCTGATGTTCTCAAGCAGACATTTGTTCCTTCTTTACATCACAGACACTGTTGCAGT
GGAGGAATGCCAGTGGTCTTCAGGGGAGACCTTCAGATCATGGGGTCCCTGGACATTGGA
AGAAGCTCATGGACAGCTGTGTCATGGGGCCTTTTGTGTGCTATTGGAATTTTAGGGAAG
GTAAGTGTGACTGTTCCTGAGCAGGCCTATTTGCCTCTTGGTCAGGGGCATAAACTGTGC
ATGGATCGATGATGACTTCCAGATATGCATTCCTTGGAAAGCTGAACAAAATGAGTGACA
ACTCTATACCGTCGTCCTCATCGAACTGAGGTCCAGCACATGTTTCCAACATGATATGGC
AGAGACAGAAAGAGAGAGAGAGAAGGGGGGGGAGAAAGGTATAGAAAGAGAGAGGGTCGG
CTTCCATATGTTCACGTGGCTTCCAAACTTGTATTTATCAGGCCTTGGGACATGGTGCTG
CCAGAGCAATGGAGAGTCACTGGATAGTTCGCCATTTCCAGTTGAGGACATGGTCCAGAA
GGAGGAGCAGAGTTGGTGACAGGAGGTGAGCCCTGGCCCTCCCCCGTGGTGTGGCCTTAG
CAAGTATGCATTCCGCAAGGAAANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNTGGGTCATGGTGGGGCCCAGGAAGGCACATGAAGTTTGTGGGGATGTCCAAGACATG
CTGTGTCCATGTGTGTGCAGGAGGAATTAGTGCGTAGAACTGGCAAACACTTGCTTTCCA
AATAGAGTTGTTTTTTAGAGTCCCAAAGCAAGGGGGCCACTAATCCCATTGGTTGCTGAG
GTGGTAGTGTTGTTAGGTGGCTGGCCGGCTGTCATCCATACACGTGGATGCTTTTGCAGT
GGGAGGAGGATGGCATTCCATGGATCTGTGTGAAACCTGTGGGGAGGCCCATCCTGGAAA
AGTGTCCGTGTTTTAGTTTGCCAGGACGCTGTTGGGATTACCTTTGTATTCACGTTCTTG
CCATTGCTGTCCTTGGTGAGATAGTTGGAAGTGAATCACATGTGCCCAGGTCAAATCTGG
GACATATTTTTGATTGCCAGGCTGCATCTGTGGGCAAGGTTGGCAGCAATGGGTGTTCTA
CCCAGGCTCTGGGTTTCAGTTGGAGGTGGCCATTCGTGGTATGGGCATTCGTGAGGAGCA
CTGGGTGGAGGCAATATCACATGAGTAAGAAAACTAAGTTCTGTTGATTGTGTTCCCCAC
CTCTTGGTAGAGCAGACTTTTGGTGAGATTGGGGTGGTGTTAATACTTTGTGGTAAAGAG
GGACACATTTCTGTCTACTGCCGAATTAGTTACACCCATAACCTGTTTCCATGGAAACAT
TTCTGAGACCTGGCTTGTTTCCCCCCAAGAAAGGAGGAGGACACTGTGTAAGGGTTAAGG
CATAGGCCACATTGGGATTGGTGCTCAGGGTTAGGAATTGGGAAGGTACTTTTGGTTTTC
CCTCATCAAGTTGTTGGTGGACTTACTGACAGCTTGCATAAGTCACGGATAAGTCATGGT
GGTCTTGCTGATTTTCTTCCACATGCTGGCCCTTGAGAAGATCCCCCACATCTGGGTAGC
AATGTCACATAGAGTGTGTTGTGAACTAGAAATATGGTATATTGTCTGGGACAGGTTTGC
TGTAGTGCCAGCCCAAGCCGTAGCGATTCAGATGGAAGGTGGTGATAGTCCTGGGCTTAT
TCTAATCTAGGCAGAGGTCAAAGGCATCCTACTCAGCTCTGCAGGCATCCAGCGCTATAT
TGTGTGACCTTGCTAACACTGAAGCAAGGATTAAAAGTTTCAGTAGTGTTTTACGGCACA
ATGCCTTGGAGACGAACTTCCCTTCTTCCTTCTGAGGGGTATTTTTCCAACCAGTCCTCT
TCATCTTCTGTGTGACAGAACCACCACTACATGTTAGGACAAAGCTCAAACATGTAAGGC
CAGTATACATATGTTTCTACTCACATGAACTGGGGGAATCGAAGGAACATGTATTTGATA
ACCAGCCTGTATCTGTGGGCAAGGTCAGCAGCAATAGGTGCTCTTCCCAGGCTGTGGTTT
TCAGTTGGAGGTGGCCCTTGGTGGTATGGGCATTCATGAGGGTCACTGGGTGGAGGCAAG
TATCACATGAGGAAGAAAAGTAAGTTCTGTTGACTCGTGATCCCAACCTCTTGGCAGAGG
AGACTTTTGGTGAGATTGGAGTGGTGTTAATTCTTTGTAGTGAGGAAGGACAAATTTCCC
TCTTCTCCTGAAGCAGTTTCAGCCATAACCTGTTTCCACTGCAGCATTTCCAAGACGTGG
CTTGTTTCTACCCTGGGAAGGGGAGAGGACACTGTATAAGGGTTAAGGCATAGGCCATAT
AGGGATTTGCTCTCAGAGGTAGGAATTAGAAAGATAGCATTGGTTCTTCTTCATCAAGTT
GATGGTAGACTTAATGATAGGTTGCATAGGTCACGGTGGTCTTGCTCATATTCCTCCGGG
TGCCAGCCCCTGAGGAGAGCCTCACATCTATGTCATGTGGACTGCATTGTGAGCAGGAAG
TATGGGGCATTCTCTGAGCATGGTCTTTTGGACTTCAAGCCAAAGGTTTAGTGATTTGGT
TGGGGGGTGGTGATAATCTCGGGCTAACTCCAATCCACTTGGAGGTCAAAGGCCTTCCTG
CTCACCTGTTCAAGCATGCAGGGGTAAATTGAGTGACCTTGCTGACACCGATGCAAGGAG
TCCATGCCTCAGTGGTATTTTGTGGGACAAATTGCTAGAGATAGGTAGGAAGCTGATATG
CATCAGGCCAGTGTGCACATGTTTCTCCACATTTGAATGGGGGGGACCAAGGAATTAGAG
ATAGATAGGAGATATACCTAAAGGGTGGGTGAGCAAACATAAGGTTCTTGGGACATATGC
ACTTTCCACCATTCTGAAGTACTTGTGTGTTTGGGTCTGTCCAGAAGGTGGTGTGACACA
GCAGAAACACCAAGACCAGGTGAAAGCCAAGTGGCTGATGTCTGCTAACGGGAAACACTA
GGAAGCCCATGAACACCTGCAGCATGGCAAAGTGATCCAGCAATCGTGAAAGTAAGGGAC
TCTTTTCCCTACACAGTAACTTTCCTAACATTCTAGGCCACAGAACGTGCATGGATCGAT
GATGACTGCCAAGAAACATTCCTTGGAAAGCTGAACAAAATGAGTGAAAACTCTATACCG
TCGTCCTCATCGAACTGAGGTCCTGCACGTGGCTCGACCAGGGAATAGAGAGGGAGGGAT
GACCTCCGCCTGTTCACGTGGGTGGCACCATGGGGTCGCTCTGGGCATTGAATGTGGTCC
GTTGTGTGAAGGCAATGTTCCCTCTTTACATCAAGTGGACATGTGTTCCCTCTTTACATC
ACAGATGCTGTTGCAGTGGAGGAATGCCAGTGGTCCTCAGGGGAGACCTTTGGATCGTGG
GGTGTTCGGAAATGGGAAGAAGCTCACGGACATCTGTGTTGTGAGGCCTTTTGTGTGCTG
TTGGGGTTCTTGGGATGGTAAGTGAGCCTGTTTCTCAGCAGGCGCATTTGCCTCTTGGCC
AGGGCCAAGAACTGCATGGAGGGATGATGCCTTCCAGATATGGTTCCCTGGAAAGCTGAA
CAAAATGAGTGACAACACTATACCATTGTCTTCATCTAGCTGAGGTCCAGCACGTGTTTC
CAACGTGATATAGCAGAGACATACATATGAGAGCGAGGGGTAGAAATAGAGAGGGATGTC
TCCATGCATCATNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCAGGCTATCCCCACTGGTTCCT
GTCTGGGGAGGTACCGAGAAAAGTTGAATGCATTTGGTTTTCGGGCGCACAGGGACCCCC
GAGTCCAGTACCCAGCGATGTCTCGTGCAGGTTGGGAAGGGTGCATGCTGTGGGTGTGTC
AGCTTGCCAGCCCACTGTGGAGTTTGGTGCCTAGCAATACCGAGTCCGCCCGTATGGGTT
GGGTCGTGGTGGGGCCCAGCGAGGCTCATGATGTTTGTGGGGATGGCCAAGAGATGCTGT
GTCCACGTGCGTGTAAGTGGAATTTGAGGGTACAACTGGCAAACACGTGCCTTCCAAGTA
CGGTTGTGTTTCTTAGAGGCCCAAAGCAAGGGGGCTACTAATCCCATTGGTTCCTGAGGG
GAGGTTGTTGTTAGGTGGCTGGCTGCCTGTCATCCATACACGTGGATGCTATTCCGTTGG
GAGGAGGATGACATTTCATGGATCTGTGTGAAACCTGTGGGAGGCCCGTCCTGGGAAGGC
ATCCACGATTCAGTTCCCCAGGACCCTC
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved