Otolemur_garnettii Locus Mono:196:SNORA9
snOPY snoRNA Orthological Gene Database
Otolemur_garnettii Mono:196:SNORA9
Otolemur_garnettii
Mono:196:SNORA9
scaffold_61697
SNORA9
1001..1124
2124
TTCAAACAATCCTCTTGCCTCAGCCTCCAGAGTAGCTGGGACTATAGGTGCCCGCCACC
ACACCCAGCTAATTTTTCTGTTTTTAGTAGAGACTGGGGTCTCACTCTGGCTCAAGCTGG
TCTTGAGCTCCAGCATTTCACCCACCTTGGCCTCCCAGAGTGCTAGGATTACAGGCCTGG
CTTCTTTGGGTTTTTTGTTTTTTTTTTCATTTTTATTTATTTATTTTGCGTTTTTTGGTC
AGGGCTGGATTGGAACCCGCCACCTCTGGCATATGGGGCCGGTGCCTTACTCCTTTGAGC
CACAGGTGCTGTCTAGGCCTGGCTTCTTTGATTTTTTTTTTTTTTTTTGGAGACAGAGTC
TCACTATGTCACCCTGGGTAGAGTGCTATGGCATCACAGCTCACAGCAACCTGAAACTCT
TTGGGGGCTTAAATGATTCTCTTGCCTCAGCCTCCCAAGTAGCTATGACTACAGGCGCCT
GCCATACGCCTGGCTATTTTTTGTTGTTGTTGTATCTTTGTTTGGCAGGCCCAGGCTGGA
TTTGAACCCGCCAGTTCTGGTGTATGTGGTTGGCACCCTAGCTGCTGAGCTACAGGCACT
GAGCCTTCTTTGATGTTTTTAATTGCACCAGGTGGGACCTATCAGTCTACCACCACCATT
GACTAAGTGGCATGCAAGCCATCTCCCTTAACATGTGTCCATAAAAATAAAATAAAAACA
AGTTCTATTTATTTTGCTTTCTACATATGTCACGGCCAGGGTATGACTCAAGCCTGTAGC
CCCAGGACTTTGGGAGACTGAGGCAGGAGGATCACTTGAGGCCAGGAGTTCAAGAGTAGC
CTGGGCAACATAGTGAGATTCCCCCATCTCTAAAAAAAAAACTAGTTTGGCTTAGTGATG
CACACCTATAGTCCCGGCTACTTGGGAAGTTGAGGCAGGACAACTTGACCCAGGAATTTG
AGGTTGCAGTGAGTTAAGATGAGGCCACTACATTCTATCCAGGGCAAGTGAGACTGTCTC
CAAAAATGTGTAGATTCCTACCAGGGCTTGCCAAAACAGTTTTGAAATGCTTTGAGGTCT
TGCCCTGCTCTATCTAGAGCAAAGTTATAGAAATTTTGGAAAATAAGCTAGGTGAAGTGG
CTTGGGCCTTTGATTCCAGCATTTTGGGAGGCTGAGGCAGAAGGATCTTTTGAGTCCAGG
AGTTCAAGACCACCATGGACAACATACAGAAACCCTCCTAATTTCTTAAGAAAAACTGGC
TGGGCAAGGTGGCTTGCTCACACCTCTAATCCTAGCACTCTGGCAGGCTGAGGCAGGTGG
ATTGCCTGAGCTCACAGGTTTGAGACCAGCCTGAGCCAGAGTGAGACCTTGTCTCTAAAA
ATAGCTGGGGATTTTAGCGGGTGCCTGTAGTCCAACTCCTTGGGAGGCTGAGGCAAGAGA
ATTGCTTGAGCCCAAGAGTTTGAGGTTGCTGATGCCATGGTACTCCATGAAAGGCAACAA
AGTGAGACTCCATCTCCCTCCGCCCCCCCAAAAAAGAATAAAAACTTAGGGCAATGTGTC
GTGGAACACAACAATATTCCCTGCTACAGGTAAGGCTAATGTAAGGGATAAAGCTTGACC
CCAGGAGTTTGGAGCTATAGTGAGCTGTGCACTGCACCACCACACTCCAGCCTGGGTGAC
ATAGCGAGATATTGGATAATAAGCTTGTTATTACAAATAAATAAGTCTGAATGCTGCCCT
TTTCTCAGGAGTGAATTCCGGTGGAGCTCACCACTTTGCGAAGGCTTCATTTGGGAAGGG
TGATATTTGTGAGGACCACATGATGGTAGAGTCTGAGAAGCTGTGCTAGATCGTCCCCAT
TACAGACTATAACCTTAAATCCTTCCCTCGACTTAAAAGTTACAGGGAAGGGACTTTCTN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNN
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved