Otolemur_garnettii Locus Mono:209:SNORD30
snOPY snoRNA Orthological Gene Database
Otolemur_garnettii Mono:209:SNORD30
Otolemur_garnettii
Mono:209:SNORD30
scaffold_70608
SNORD30
1001..1067
2067
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNCCCGGTGTATGTGGCTGGCACTTTAGCTGCTGAACTAA
AGTGTGCTGAGCCTTATGTTACCTTTTTTGAAGAAAAGCTCACTACAGATGTGTGGATTT
ATTTCTGGGCTATTCTGTTCCATTGGTCCGTATATTTGTTTTTATGCTGGTACCAGGCTA
TTTTTTTTTACTATATGTCTGTAGTTCTTTTTGCTCAGGATAGCTCTGGCTATTCTGGGT
CTTTTGTGGTTCCATATACATTTTAGAATTGTTTTACTGTTTCTGTGAAGAATGTCATTG
TTACTTTGAAGGGGATTACATTGAATGTGTAGATTTCATTGAGTATTGTGGACATTTTAG
CAATATTGATTCTTCCAATCCATGAGCATGGGCTATCTTTCCATTTTTTGGTGTTATCTT
CAATTACTTTCATCAATGTTTTTATAGTTTTCATTGTAGAGAATTTTGACTTCTTTGGTT
CAATTTATTCTTAGGTATTTCATTTTATTTGTAGCTATTGTAAATGAGATTACTTTCTTG
CTTTCTTTTTCAAATTGTTTGCTGTTGACATTTAGAAATCTGATTTTTGCATAAAATATT
GTATTCTGCACCTTTACTGCATTTGTTTATCAGTGCTAATCTTTTTTTGTGGAGTATTTA
GGTTTCTCTAGATGTAAGATTATATTGTCAGCAAACAAGGATAATTTGATTTCTTTCCAA
TTTGGATGGCTTTTATTTTGTTCTTTTGTCTGATTGCTCTGCCTAGAAATTCCAATGATA
TCTTGAATAACTGAGGTGAAAGTGAGCATCTTGGCTCAGTGGGTAGGGCGCCAGCCCCAT
ATACTGAGGGTGGTGGGTTCAAACCCAGCCCTGGCCAAACTGCAACAAAAAAATTGCTGG
GTGTTGTGGTGGGCACCTGTAGTAGCACCAGCTACTTGGGAGGCTGAGGCAAAAGAGTTG
CCTAAGCCCAGGAGTTGTAGGTTGCTGTGTGCTATACCATGGCACTCTACTGAGGGCGAT
AAAGTGAGATTCTGTCTCTACAAGAAAAAAAAAAAAAAAAAAAAAGAAAGTGACATCTTT
ATCTTATTTCAGATCTTAGCAGAAATGCTTTCAGTTCTTCCCCAGGTAATATGATACTAT
TAGCTGTGGGTCTATTGTACAGGACTTCAGTTGTATTGAGGTACATTCCTTTATATCCAG
TTTTTTTGAGAGTTGACAGAAAGTTGAATTTTATTGAATGCTTTTCAGCATCAGTTGAAG
TGATCATATGGATATTGTTCTTTGTTCTGTTGATATCACTTTGATTGATTTTTGTACGTT
CAAGCATACTTGTATCATTTGGATTAGTATAAGTTGCAATTGATCATGTTAAATAATCTT
GTCAATGTGTTGTTGAATTCTATCTATCAGGGTGATACAAGCCTCATAGAATGAGTTCGG
GAGTATTCCCTCCTCCTTGATTATTTAGGAATTGATTAAGTGGGATTGGTATTATTTTTT
CTTTGACTATTTGGTAGAGTGAAGCCACAGGGCCCTGGTTTGATGGGAGACTGTTTATTA
TTACTACTTCTATCTTGTTACTTATTAT
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved