Otolemur_garnettii Locus Mono:318:SNORA64
snOPY snoRNA Orthological Gene Database
Otolemur_garnettii Mono:318:SNORA64
Otolemur_garnettii
Mono:318:SNORA64
GeneScaffold_2990
SNORA64
1001..1132
2132
AGATGGAAATAAGTAACAGGACCGATGGAAAACAAATAGCAGGGTAGAAGAGTTGAACC
TAACTGTGCCAGTGGTCACTGTAACTGTAAGTAGACGGAGACCCCTGGACTGGACGTAAA
TGCTACAGGCTGTTTTCAAAAGGTGCATCTTAAAATATCAAGATGATTTATAGCCTACAT
ATTTAAAAAAGACACTAAAAGTAAAAAGAGGAAGAAAAAGATACACCACACAGGTGACTA
ACCACAAGAAAGGTAAGAGAACTGTACTTACATCAGAGCAGACTTCAAGATGAAGAGTGC
AATGGAGAGAAGCATTTCATCCTGATAAAAAGACGGGCTCTCCAGGAATCCATAATAATC
CCGAATGTGTATGTACCTAACAAGAATATGTCAAGCTACAGAGACCAAACTTGACAGCCA
GAGAGAAAAACAGAGAAATCCACAATCAAAGTAGGAGATTTTAACACGCTCCTCTCAGGA
ACTGACACAGCAAATGCACACGTATGAATTTATTCAGGACACAGAAGCCTGGACGACATC
ATCAACCAGCTTGGCCTCAGTGGCATCTACAGCCCACTGTTAGAGTAACTGCACAGCACA
CACTGATGTCAAGTGCACAAGGTAAGTCATATCCGAACACAAGCAAAAAACTCCAGTAAA
TTAAAGGATTGAAATCATACATAATATGTTGGTGTAACACAATGAAATTAAATTAAAATT
AACCATAAAAGATATCCCTACATTTGGAAATTAAGCAACGAACTTCTGCATGATCCATCA
ATCAAACAATAAATTCACAAAGGAAATTAGGAAATATTTAGAATGGAATCATTATAAAAC
CGATATAACAAGATGTGTGGGATGCTGGTAATTTTAAATGCTTATAGGACAAAAATAAGA
GAAGTTTAAAATCAGAGATCTACATTCCGTGTTAGGGTGGAAAGCTTAGGTGCTCACGGC
TTGGGGAGAAAGATTTCTCCAAGGATCAGGGTGTAGAAGGCACCCTCCCAGCTCTGCATG
GTCACACCTGGCTTTACTCTTACCACTTTCCTAATGTGGAGAGGGGGGATAGGTCTCCTC
AGGACCTGGGTTGGCCTTCCAGCGGCCTCTCTTTCCCTGAGGGTCCAGCAGAGTCTTCTC
AGTGGGTACTGCTACTGTCATAGGACTCCCAATCAGAAGGGGAAAAAAAGGAAATAAAAG
GATAAAATTTATCTTACCTTCTGAGAAAGAGGAGGGAAGGAGAGATGAAAGACAGTGGGG
AAAGGGTAGGCTGGGGGGAGCAGGGAGAGGGTGGCAAGATCCCCGAGGAAGCAGGGAAAT
GCCAGGTGATTAAGGTCCCATGGGGAGGGGGGAGCAGGGATGGTTCTGTCATCCAGACCC
GACTCTATACTCCAGAGACTGCTGCACCTTTCTGTCTTTTCCTGGGCTGGTGGATGACAA
AAACTGAGGCTCTGGCCTGGCTGGACGTCAGCGCCCAGAGCTGGCTCCCCTCTTTCTCTG
GATTATCTTGGAGATAGGATTTCTGAAAAAGAAGATTCTCAAAAATCAATTTTAAAGAGA
AAAATTTACACCTCTTTTCTGTCCAGCTCTTTTCAGAAATTGTGCAAAACAGACCTCCCG
AGGAGGGGAGCCTGTCAGCACGAGGACTCTAGGACTGATCATTAACTGTTACTAGGAAAT
TGTAGGATTAGGTATTTTCCTGCTATTTTTGCGAGGCTACCCCTTTCACTCCGTCTTAAA
CTAAAAAAAGTTCCACAGTGTATACAAGTTTCAAAACATCATGCTGTATACCATTTGTGT
ATACAATCTTTTATCTGTCAGTTAAAAAGGAAATAAGTAATAGTAAAATGTGACTTTGTG
TGTGCTTAGATACCACTGCTCATCTGGTGCCCAGAGAAGGGAAGTTATAGTCCAGGGAGA
AGAGAATGAAAGTGAGCTAAAAAAAGAAAAAGAAAGAAAAGGTTTAAAAAAAAGTAATTA
AAATTCAAATGAAAAGAAGGAAAAATAGACATCAGAACAGAAATTTATGATCTAGAACAT
GAAGATGACAGAGAAAAATCAACAAAGCAAGTCATTGGTTCTTTAAAAAAAATATTTATA
AACCCAAGCATTACCAAACAAGGAAAAAGAGAG
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved