Otolemur_garnettii Locus Mono:161:SNORA2
snOPY snoRNA Orthological Gene Database
Otolemur_garnettii Mono:161:SNORA2
Otolemur_garnettii
Mono:161:SNORA2
scaffold_118399
SNORA2
1001..1130
2130
GCCTCCCAGGTAGCTAGAACTACAGGTGCCTGCCACAATGCCTGGCTATTTTTTGTTGT
AGCTGTCATTGCTGTTTAGCTGGTCCAGGCTGGTTTTGAACCCGCCAGCCACAGTGTATG
TAGCTGGTGCTGTATCCACTGTGCTACAGGTGCTGAGCCAAGAAAGCTGCAAACTTCTTG
AGCCATGGCATAGAAACATTCTTTACACAATAATTTTGTATGTCAGGAAGTAAGACTGCA
AACAAATGATCTCATGGGATACAGCCTCAAAAAATGTGCCCCGGCCACCGTACTAAAAGT
TCTCAGTCAACTGGGATTTTATCCTGCGGTAGATTAGAAAATGAGTTCAGATTCCATCTC
TAGTGGATGCTTCTTTCCTGGTGCAAACTGGTGTCTGAGAAACTGGGACTTTTCTCCAGA
GAAAGTCATTGCTATGTATACTCCAGATGGTTTATTTTAAACATAAAGTGACTTTTGGAT
GATAAAGTGAATAACTATTTCTTAGACAAAATCAGATAAAAATAAACTCAGAGATTTGAG
GTTATTGTCACTAAGACGAAAAAGACTCAAATGACCAATATCATAAATGCAACAGGATCA
TCACTACCTATTCCACGGACATCAGAGGCATACTAAAGGAACTCTGTGAGCAACCCTGCA
CCTGCAGATTTGGTAGTGTACATGAAGTGGACCAATTTCTTAACAGACATAAACTACCAA
AGCTCACATAAGGGAAAGCAGATAAACTGAATAAGCCTATTTGTATCAAAGAAATAGAAT
CAATAATTAATAACCTTCCAGAGAAGAGAAAGCACCAGCCCCAGCTGGTTTCCCTGATGA
ATTACACCAAACATTTCAAAAAGAAAGACCATAAATATTCCACAATTTCTTCCCGGAAAT
ATAAAAAGGATGCCTACAATATAATCCTTTCTATGAGGCCAGCATTACTTTATCACCAAA
AAGATAAAGTCAGATAAAGTCACCACAAGAAAGGAAAGCTAGTGGCCCTGACTGAGCAGT
TATTCTGTAGCTGTTGGTTTCAAACAGAGGCCTCAAGGACTGTCTCCTATGGTCTGTCCC
CTGTTCTAGAATCTCAGTGGAGAACAGCTATTTCATGTGGAAGAAACAACCCACAGCTCT
CTCTCTTTGGAAAAGCCTCAGGAATGCTACAATTAATGATTTCTGACTTTCAGAGGCAGG
GGTAGCCACGTATGGGACAGCACACCTGCCCAGAATTATTTTATTTTTGCTATCTTATTC
TTGTTGCTGCTATAAATGAGCATTGAAAAATCATATCAGAAAAAAAAGGAAAGGAAAACT
ATAGACCAATATTTCTGAACTTCCTTCAGAAAAAAAAGGAAGGAAACTATAGACCAATAT
TTCTCCTGAACACAGATGCAAAAATTCTCCAAAACAATGTAGAAAATCGAATCCAACAAT
TATAGAAAGTATTATACACTTGGATTTATTTTGGGTACAGAGGTTGGTTCAATAATCGAT
TAATATAATCTATCTCATCAATATGCAAAACATTGAAAAATTATAGGAACACATCAGTTG
ATGCAGAAAAAGCATAGGACAAAATTCAATACCTATTCATGACAATCACATGTGGCGAAC
TAGGAACAGGAGCAGTCTTTCCCAACTTGACAAAGAGCATTTATAAAATGCTCAAGTTAA
TATTGTTCTCAAGAGTAAGAATCCTGGCCATTTCTCCCTCACATCAAGAATAAATCAAGA
TGTCTTCTCCCACAACTCCTTCAATACCACACTAGAAGTCCAAGCCACTGCAATAAGACA
AAAAAGAAAATAAGAGGTATACAGATTGGAAAGGAAAAAATAAAACTTTTTGTTGCAGAT
GACAAGATTGCCTATGTCCACACCCCCAAATAATTAACAAGAAATCTCCTGGATTATTAC
ACTGAATAGAGCAAGTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGGTC
CCAAAAATGTATTTTTGACATTGCTTCAATTGCCCGAGGGGTTCTCCTCATAAAATTTTT
GCCCAAGTCAATTTCTTCCAGTATTTTCCCA
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved