Otolemur_garnettii Locus Poly:3:SNORD113
snOPY snoRNA Orthological Gene Database
Otolemur_garnettii Poly:3:SNORD113
Otolemur_garnettii
Poly:3:SNORD113
scaffold_116154
SNORD113, SNORD113, SNORD113, SNORD113, SNORD113
1001..1074, 2649..2725, 3767..3841, 5247..5322, 7689..7762
8762
ACTTCCTTGGTCATATTTACATCAAAGTGTTTTTATTGTTTTTTGTTGGTATTATAAAT
GTGATTATTTTTGTAATATCTTTATTAGTATGGAATCTATTGATTTTTGTATGTTGTTGA
TTTTGTATCTTGCAACTTTACTGCATTTATTTATCAGTTCTAAATTTTGGGGATAGAATA
TTTGGGTTTTCTAAATGTAATATTATTTCATCAGTAAATAGAAACAATTTTACTTCTATG
TTTCCTGTTAAGATGCCTTTTATATTTTCTTTCCCTCCTAGGCTAAGTCTGCCTTTTTCC
TATAGAAGGGCTGTAGGATAGCTGATATTCATTTTCTAAGAAACAAAATTTTGGCTGCTA
GCTTTGTGAGTAAAGATACATCGACTAATGTAAGTAACATCTTAAATTCATGTCTTTGGT
TGAGATGCTTTGTTTATGAATGTTTAGTGGTATTTCAAAGGAATTAATGTCTATAATAGA
AATAAAAATCATCAAGAATGGACAAGTGATGGGAATGTGTTATGAACCAAAAAATTTGTT
TATTGTAATTTGGAACAACTAAAGTGATTAAAAAATAGGTAATAGTTCATTTGTTTTCAT
AACTATTTAACATTATGCCTTATTTTCTACCACAAATGAATTAAACTTTTTCATATTGGT
ATGACCCAGTAATAATTATTCCTGTAGCAGCCTGGGCAAATAGGGAAGACGTTGTCATTG
TTGGAATATGGTATTTTTATTACTTTTCATTAAACCATTTGTAAAACATGGGAAAACTGA
GTAAAAGAAAACCACAGAATAACTAATAGTGAATGTGGATTTCATATGAAGTGTGGATGT
TAACTAATCATACATGTTCTCTGAGGTCCATCGTGGAAGGAGATCTAGTCAATAGAGAAC
CACTAAAAGGAAGATCTTGCTTCTCGAATTTTGTGGTTGTATTGTTATTACTGACCAGTG
AATAATAAATGAATGAAGATACAATGGAAGAAAAATGTGCTTGGACCAATGATGAGTACC
ATGGGGTATCTGAATGGGATCTTTGATTAAACCCTTATGTAACTCTGAGGTCCATTACAA
GGAGACATGCAATTATTCCTTTTTTGGGAAACGAGCCCAGGATCCCTTGTCATTGACTTT
TCTTGTTCTTGAGAATGAGTTGCATTTTTATCATAAAATCAAAATATGAATAAAAAAGTA
TCAGTGAGTAAAACAAAAATGATCAATCACATATTAAGGAATGTAATGAAACATGGATTA
TATTAAAACTTGTCTGAGACTTAAATCATTTGTGAAGGCGCTACTAATCTAATTAGGGGT
GTAAGGTCATTGGTACATAAAAGTCAAAGTTTTTGTTCTTTTTTGGTGGTGGATTGCTGA
TTGTTTTATTAATAAAATGAAACATATTTACTTACATAAATAGTTGGTTAAATAGCCATG
AAATTGAGAGCCCAGCAGAGACCAATGATAAGAACATTAGTGCAATTATTTTACTGATTT
TTATTAAGACAATAAAAATCTGTTACTCCTGAGGGCAGTGACTATGGACAAATATTTTTC
AATGTTCTTGTCCTGTTCTGGGATAACACAGACATTGATGTCTGCTTATATGAGAAAGAA
GACATGCTTTGATGTCTCAATTTGTTTTTGAAAGCCAGCAGACCATAGACCAATTAGGAA
GAAATGTTGTGATATGAGAACATTGATTAATTTTTTTTCCATTATAGATATTCTAAGAAA
AATTACAGGCTATTCCATTTTGTTTGAAAGACATACATGGGCCTTTCAAAGTTGTAGTCA
TTTGGTTTCTTAGAAAAATGAGAACATGTTTTTAAAAACAGGCTTTTTTTTTCCTCTATA
GAATGAAAACCACATAGCTGATTTTATTATTCTCTATTCATGAAGCCTATAACCATTAGT
TCTGGACTAAGGAGCATAAACACTGATGTAAGTAAATATCGACGATGTAAGTAAACATCA
ATGTTGATGTTCTTGGCTTGGATGGTGTTCATTCACTGGAGCCCACTAAATTATTTCAAT
AAAGTAAATGGTTGAATAAGACATGAATTAAGGAGGGCCAGTCATGGGCCTATAAATTGG
AATGGGTCATGAAGAAAAATTTATGCTTAATTCAACCCAATCCAGTGTAGAGCATAAGAG
ATGGGAAGGCATTTCACATATTGTCGGAGGAATTTTAATTCTCATTGAATGTTTTTTGCT
ACAGTTGTTTAGTATATTTTCTCATTGACAAATATCTGAATTGCTAGTTTTTTGAGGCAA
ATAGCATACGTCAATTTTTTCAATTGTGGGCTAAAGTGGGAGGCCTTTGGTTGTTGATTA
CACCAGCATTAATAGACAACTCAAGTGCAATAGGGGCAAATAGACACTAATCATAAGCTT
GGAATTGATATGAAGCAAGGGTGCTGATTAATCCATATGTGTAAACCTGAGGTTCATCAA
AAAAAGTGACCTAGTCTATTTTCTCTGCATGAAAGGGAGTAATGAACAGATCTTGGTTCT
ATTAAAGCCCTTTGTTCTCAGTTTTGTGTCATTACAGGGTATTGATCGTATAATTATCAT
TTATGAAACTATGAATGACTGAGTCAGTTCAAGAAGGTATAAATGAATGAAGAAATGGAA
AGCCAAGCCTGGATCAGTGATGAGTATTGATGGAGGCGTCTGAATCAACACCTTTGATTA
AGCCCTCTGTTTACTCTGAGATCTGTTACTGAATGAGAAACAGCCAATATTCCCTGTAGA
AAATATGTAATAGAAGTTAGGAAAATTCAATAAACTTGTTCCTGGACTTTTGTGGTTGAA
AGATATGGAATGTATTATTTTAAGGAAATCACGCACGCATAAATAAGTAGAGAAGTATAT
ACATGAAAGAAGATGAACAGACCTATTCAAGGAGCAATTTTTTGAATGAAGTACAATAAG
TATTATTAATATTTTATTAATGTTAATACAACAAAACAAATGTAATTATTAATCTGAAGT
AAAATTGTTTTTTACATGGAAGCTATTAGTATCTTAGTTGAGAGACAGTCTTTTTTTAAG
TTAAGAAAAGTGTTTGATAAGTCACTGTCCACTTAATAGTTGTTTATATAGCAGATATTT
GTAATCATAGATCTTTTTCTTGGGTTAGGTAGTATATATACTTATTGTATTATAAGTACA
TAACACTTAATATATATTTAAACCTGAAAGTTCAACATAGGGCTACGAAAAATTACATTC
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCCATGGTTG
ATTTCCCTTTGGGGAGAGACCCTGGCTGATAGCTCCTTCAGTGTAGCCTGTAAGACTATG
GATTGTATGGTGAGTGTTTCAGAGGTGAGAGAAGATGTTGGTTTCATTATTTTTCATTGA
ACCATTTTGACAAGACTATGAAATTCAGCCCTCTTGTTTTTGAGATTTTTGATTATGTTA
CATGTGAATTGGTAAATTAATCAATAAGTGAAACAAAAATGTCCATCATGGACAGTGATG
AATGTCATGTGGCTTCTGAACAAAAGATTTTGATTAAGCCTATCTGGAACTCTGAGGGCC
ATTATTAGAGAGAAAGATACCTCATTATTCTTTGAGGGAAATGAGTATAAGAACCTTGTT
CATAGACCTTTGTAATTTGAGGGTATGAATTACATTATTATAATAAAATTAGCTTATGAA
TAAATAATTGTATCAATGAATGAAGAATAAGAACAATATGCATGAACTTATTTTTTAAGG
TATATGATAAAAAATGGACAATTATAAAAATATTCTTGAGATTCCTAGTCCCAATAAATT
AGTAGTGAAGGCTCTTATCACTTATAAGGAATATATGGTCATCTGTACAAAAAAATGAAT
TTTTTTGATCTGTATTTAGGCAAGTTGCATAGAGACCATTTAATTAAGAAAAAGAAATAC
ATTTACCTAAATCAATGCTTGATTGAATAATTATGTAATTGAGAGAGAACATGGAGTAAT
GATGGACGTTTATACAACCACACTTATGATTAATGTCATCTTTTCATATACTTATATCTA
GGCAAAGAAACAGTAAATAAAACCATGTTGGTACTGAATTCAATGGTGTTCATTATATTA
TTTAAAATAAAAAAATGTGTACTTAATAAATAGGACACAAATCTTAGTTTGTGGGTAATT
GATTACCATACAAGTATGGTTCATTTAAAACAGCTAAATGTAGACTATTTAATTCTCTTT
AAAATTTGTTTTTTACACTTCAGAATGAACATGTTCTTCCCAAATGAGTTATTATCTTCT
GGTGAAGATCCTGCCTTTTACCTCTATGAATAAGAAGAGAAGAGATCCACGTAGGTGATA
ATCAAAGTTTCATTCTGTGGCTTGGGGGACTGGATCATGTAAACTCATTAAATTATTTCA
AGGCAATAAATTGTTAGATACCTAAACAGTTCAAAGGTGGTCATGCATTGACCAATGATG
GCTATGTGTTGTGAATTAAGAATCATGATTAATCCATTTCAGCACAACTGAATTCATTAG
CACAAAAGATGAAAGACTTATCTATCAATTTTAGCATGTTTTAGTATGCTCTTTTATTTT
GGTGCCAATTGAAATTTGTTTATTTATTTAAATTGTTTCAGACTGTTAAACTATTGAGGG
GATTACATGAAAATGGAAAATCTTTTTAACTATGAAATAAGATGATGATTAACATGGGCA
TTAAATGAAATAGGTTCACGCACAGCTCAGTGGCTAATATGGCATTGATGAGATGCGAGG
AAATGGATTAATTCATCTCTGCAACACTGATGCTTGTTATACAGAGATCCAGTCCTCTAG
TCCTGTGAGATATGAATTTCATAGCTATATCTGCATCTTTTAGGGATCTTTTTTCCTCTT
AATCTGTGTATGGTGATTGTATTATTAGTACAATCAATGAGCAAATCAAGAACAGTGTAA
CTGAATGAAAGCACAGAATACCAAGTCTGGATCAATGATGAGTATGCGTGGGGCATCTGA
ATCAACTACTCTGATTAAACCCTGCTGTAACTCTGAGGTCCATTGCATTTATGGGAAATG
TGCTTGTAGAGGACATTAGACACAGTCACAGAATGTGTTCTTGTTTTTTTTTTCTTTATG
GGTATAGATTATATAAATAGAAGAAAATCAATGAATCAATAAAGTATAAGTTAAGACAAG
GATTAGAATACCTTTTTCAATTATGAAAGAAACCAATGAATTAAAGATTATTTATTGTTA
ACAGGTTTCTGAAATTTTGAGTTCAAATAAATTTGACTAAGGCTTTTTCCCCTTGGAGAG
AATAAAAATAGATGTTCTCTCTATGGTCTGGGCTTACAGTGAATTTGCATGTCTTACTTT
TAGAAAGAGATAAAAAAATGATATAACTAAATAATTAGTATAATAACATTTACTATAGTA
AATAATAGCCAATATAAATATTTATATTCAAAATTACTTAATATTATAAATAATGCTAAA
CATATTAATATATGATTATTATAACAAAATTCATATTAATGTTTAGATAGTTATAGAAAA
TATATAAATATGAAAATTAAAAATGTGAATATAATAATGACAAATGCTTTTGTTCTCACT
GATTTTTATTTAAAAAGAAAAATCCAAATGTATTTTTGATGATTTTGCTAGTGATAAAAG
AATAGGTAGATGTTAGTGTCACTAAGTTTTCATCCAGTATCCTTAGGGTTCATGAATATT
GGTGCTATCACTTAATTTCATCTCTCATTTTATTATTTTAAAGAAAGCAAACCAGATACT
AGTGAGAAGTATATGTTATGTATGAAGGAACATGATTAATCCTCCCTATCCTCTTGTTTA
TGGAAGGGTCTTATAGACCCACTCTTTAGATACACTTTGCTATGAACATTTAAATTCAAA
TTGAATAAAGATAAAAACTCAGTTCCTCAGACACACTAGGCACAGGCCAAGCCACATGTG
GCCAGTGTCTGCCATAGTGGACAGCACTGGGAGAGAACATTTGTATCACTGTGGAAAGTT
AATCAGTGCAGACAGAGCCAATACAGATAGTTGTAGGTAATAGGATTGTGTTTTAGGTAG
TAGGTGCAGCTACTACTATTTTGTGTTTTCTTTAGGAAAAAGAGTAGATAATTAAATTAT
CTGTAGAATTATTAAATGAATAAATGAAAGAATCAGTAAATATTTTAATAAAATCAGTTT
AGTCCATTGATAGGATTAATATTTCATATTAAAAATTAAATCAGTACATGAACAGGATAC
CACTATTGGGTTGAAGATCAAAGTGTAACACAAACTACTATTTATGATTAGTCTAATAAT
GCAGAACTAATCTCTATTTAAAATCTATTACACATTTACACTTTTTATTATTATTTTTTT
TTTGAAATCTGTCTTTTCCTCTACAATGGGCATACCAGATTGGATTTGGTAATTCCCCTG
TGATGAAGAATATGGCTAATGCTTCACTGGGTAAGAAGCAATGATAGTATCAGCACTTTT
GTTCTTGATTTGTATGTTTTTTTCATGTGTGATGATAGAAAAATGGANNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTAATGGTGG
GTACCTTGTGGATTTGATTGTTCATTATACATCTTACATTGGATAGATTTAATGAACATG
GATCTTGGAACCTTTATGTTGATCATAGTGACACAAAGGAAGGCTTACTGATTATTTCAC
ATGTACAGTACTAAGATTAGTCTGTTAGGTTTGTGGAGGTTTTTTTTTTTTTTTTTTTGA
GATAGAGCCTCAAGCTGTTGCCCTGGGTAGAGTGCTGTGGCATGACAGCTCACAGCAACC
TCCAACTCTTGGGCTTAAGTGATTCTCTTATCTCTACCTCCCAAGTAGCTTGGACTACAA
GCACCCGCCACAACACCTGGCTATTTTTTGTGGCTGTAGTTGTTGTTTGGCAGGCCCGTG
ATGGATTTGAACCCGCCAGTTCTGGTGTGTGTGGCTGGCACCTTAGCCACTTGAGCTACA
GGCACCCAGCCCAGCTTTGTGGATTTTGCACCTACAGATATTATAGTTATGTCAAGGATA
TTATTTTTGGAAATTTATAATTCATGGGAAAATGAAGGTGTAAGTAAATGGAGAAAGAAC
TGCCAAACCTGGACCTATGATGAGATTGGAGGGTGTCTGAATCAAAAACTTTGATTAAAG
CCATCTGTAACTCTGAGGTCCATTATTTAAAATGGCCTTCCTTTTATCTTTTTTGGAAAT
GAGTTTTTATTTTTTATTTTTAAATTTTATTTTTTTATTATTATTATTTCTGAGACAAGA
ATCTCACTGTGTCACCCTCAGTAGAGGGCTGTGACGTCACAGCTCACAGCAACCTAAAAC
TCTTGGGCTTAAATGATTCTCTTGCCTCAGCCTCCCAAGTAGCTGGGACTACAGGCACCC
ACCACAACACCTGGCTATTTTATTGTTGCAGTTCTCATTGTTGTTTAGCAGTTTAATTGG
AAATAAGAATGAGCACACTTCATCTCATTATTACTAATTAAATTGTTATTAGTAAAGTAT
TGTTCACTGCATTTTATCAAAAACAAGAAAAATTCTAGTTTTTAAATCTCTGTAGGTAAT
AGACACTTAGAAATATAGCAGTGTTAAGACTTTTATCTAATGTTAGTAAATTCTCATATA
TTGATGAGTTGTTACATGTGAATAGAGTATGTTATCAGAGCTAATATTCTGAAAGAGGGC
TAAGCATAGGCCAGGAAGAAGTAAACCTAATGATTCATTGTCTATTCTAGTTATACCCTG
TTCCTAGTTTTGGTATGGGAATATAGATGCTTAAACATAAACGTAAGCATTTCTGCATGG
GGTTTTCATAGACTTGTGTCTGTGTTTATGTGAATGTATAATCAAATATTCCATGGGTCT
TTCTGTAAGTGAATAAATAAAATGATGAATGATTGAATCAATACAATATGTAGGATCAAG
CATAGGCCATTGTTAAAAATATACCATGAATCATGAATTTAAATTTATCCATTTCTACAG
AAGTTGATTCTATCAAATAAAAGATTATCTAACTTCTTAGTATGTGGGTATATCTGCCTA
TAGACAGATGTGTGCAATATTAATAGTTCTTGTTTTGTGTGATGAATTTAAGTGTTTTTT
GTATTAATAGTTAAAAGAAAAAATAATAAGTGATATTTTGGGATACTTGAATCAACTTTG
TCA
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved