Otolemur_garnettii Locus Mono:91:SNORA66
snOPY snoRNA Orthological Gene Database
Otolemur_garnettii Mono:91:SNORA66
Otolemur_garnettii
Mono:91:SNORA66
scaffold_103263
SNORA66
1001..1117
2117
CTTTGATGCAGATTTTCCATTCCACTACATAGAAGATTAATATATATACCCAAGGGTGA
TTAAGTAATTTTAATTTTTTTTACTGCCTCATTGTGGGCATTCTTAGGTAAAACTAGCAT
ATTATAACATGAGTCTACAACAATGAAAAACTACAATGACTACCGTTTGGTGTCACTGCC
TTGCTGCGTACACCAAAAGTTTTACCCACCATTACACTTTTTATTTTTTTAAGAGACAGA
GTCTCACTTTGTTGCCCTCCGTAGAGTGCGTGGCGTCACAGCTCATAGCAACCTCCAACT
CTTGGGCTTAGGCGATTCTCTTGCCTCAGCCTCCCGACTAGCTGGGACTACAGGCACCCG
CCATAACGCCTGGCTATTTTTGTTGCAGTTTGGCCAGGGCTGGGTTCCAACCCACCACCA
TAGGTATATGGGGATGACACCCTACTCACTGAGCCACAGGTGCTCCCCCCAACCATTACT
CTTAAGAATGTAAGTACAAATGTCAATACAGTGCAAAGTGCAAAGGGCATCTTAATATCA
TTACGGAAATAGATTTGACCTTGTAGATTCTAAGAGTTGCAGGAACCATAAGCCTGTGGT
CCACACTTTTGAGAATCTGAATGATCACAATTTTCTTGCTTGATTGATTAAAGTTAGAAT
AGTTATATTTTCAAAATACTGTAGCATTACTTTAGTTCTCAGTTTGTTAAGTAAAGAATA
TAAGGTTATATGATTAGAGTATTCGTTTAAGATAGGAACAATGTGTATTTTCAACTGGAG
AAGTGTAAGCAGTAGGATATCTCAATATTTGGTCTAGTAATTAAGTGTAAAGACTCAGGA
ATGGATTCAGAGTGGAGAGTTTATAGGTAGCGTTAAAGACTAGATCAGGGGTTCTCAAAC
TGTGTGTCATGACCCATAGGAACTGTATTAAAGGACTGCGGCATTAGGAAGGTTAAGAAC
TACTGGACTAGATAAACAGTCCATTAAAATCTCATAAACTTGTGCAAACTCAATCACTGT
CTCTGCATGATGTGGCAGGTTTGCTAAAGTAATTATGGTGATAGGACTGTATTAGCCTCA
GATGTTACTGAGGTTACCCATTCCATCCTAGTACAGGATAAGTTAAAAAAAAAAATCTCA
TAAAGTTGAATGAGTTAAGTACAAGGTAATACATTTATGGAAAAACAACCAGTATCAGAC
TTACATGATTAACTATAAGCAATCAGTTAAGTTCTAGATGCCATTGTATTAATATAGTCT
TCTCTGAATCTACAATTATAAAGAGTGTCATTATAGCTAAAAAAAAAAAAAACACCAAAG
CTATTGCATGTCTTTGGAAGGGTATTATAAATAGCACAGGTTGAATATCCCTAATCCTAC
AATCTAAAATTCAGAAAGTCTCCTAAATCTGAAACATTTTTAGCACCATCATGATGTTCA
CAGGAATGTTCACTGGAGCATTTAGGACTTCAGATTAGGAATTTTAATTGGTTAAGTATA
ATGTAACTATTATTTATTTGTTTATTTATTTATTTTTTGAGACAGAGCCTCAAGCTGTCC
CCCTGGGTAGAGTGCCAAGGCATCATAGCTCACAGCAACCTCCAACTCCTGGACTCAAGT
GAGTCTCCTGCCTCAGCCTCCCAAGTAGCTGGGACCACATGCGCCCGCCACAACAACCTG
GCTATTTTTTGGTTGCAGCTGTCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNTTTCC
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved