Otolemur_garnettii Locus Mono:513:SNORD75
snOPY snoRNA Orthological Gene Database
Otolemur_garnettii Mono:513:SNORD75
Otolemur_garnettii
Mono:513:SNORD75
GeneScaffold_690
SNORD75
1001..1062
2062
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTTCGAACCCCGCCACCTTGGGTATAC
ATGGCTGGCACCTTAGCCACTTGAGCCACAGGCGCCAAGCCAGAGTCTTGATCTCTGTTG
GTGGCTTGGAAAATTCTAGAAAAATAATAATGAAAGGCAACATTTACAAAGCATGTACTA
TATTTAGGGCCCTGTGCTGTACAGTTGATGTAAATTTCCACAAAGCACTCACCAAGTCCT
CACTATGGCTCTGTGAGGTTGTCACTAACAATGCTCCCATTTTGCAGATGGGGAAACTGA
GGCCCAGAAGTGCTTAGCCACTTGCTCAGTCCCCACAGCCAGGAAGGGGCTCCAGCTTCC
TTATGCATAATCTCCCAGATGCCTTGAACCCCTGGAGGTTTTGTTTTTGTTGCTCTTATG
CCCTGGGCAGGGTAAGGCAGGAAGGAGAAAGTTCATCCTGGATGAGAGGAGGGGGCTCCA
CAAATATGTCCCTCTTTGCCACCCAGCCAGGTTCATCTGTACACTGCCCAACAGAGAGCC
AACATCCAGAGACAGAAGGGTTCACAGTAGAGAAGGAGTTTATTCTGTATAGCACTAGGA
GCGGGGGACAGAAGGAATTTCTGAAATCCATCTCCCAAAGAATTGGAGAAACAGGGTTTT
TTTTTGGTTGTTCTTTGTTTTTTTTGAGACAGAGCCTCAAGCTGTCACCCTGGGTAGAGT
GCTGTGGCATCACAGCTCACAGCAACCTCCAACTCCTGGGCTCAAGCGAGTCTCCTGCCG
CCACCTCCCAAGTAGCTGGGACTACAGGTGCCCAGCACTATTTTTAGGTTGCAGCCGTCA
TTGTTGTTTGGCGGTCCCAGGCTGGATTTGAACCCGCCAAGCTCAGTTGTATGGGGCTGG
CGCCTTAGCTGCTTGAGCCACAAGCGCTGAGCCAAGAAACAGGGTTTTTAAGGATAGTTT
GGTGGGCAGAGGGTTGGGAAATCAAGGTCTGCAAATTGGCTGGTTTTGGGGTGGAACCAT
CGGTTCCTTAGTATGGGCAGCTGTATGGATGGGTCAGGCAATCTTTTGGAATGCAGTTCC
TTGGATGAATGGGTGGGTCTAAGACCAATTAAGTCAGTTTCTTGGTCTGGGTGGTCAGTC
AATCCACTGGAATGTGGACCTGGAAGATATCTCAAAAACAATCCCTAGATTTGGAACAGA
TGATGTTATCAACAGAGAAAGTTAAGAAGTTTTACACTACCAGCTGTGTCCCCTAGAGTC
GCAACTATAGAGAAACAAACAAGGGGACAGTGACTATGATCAAGTAAATGAGTGGACAGT
GGCTGGTTATTATCATTGTTTTAGCTAGGCCTGTTCCTTCACAACATTTGTGGGGCCCTT
ACTCTAGTTTTTACCTTGTACCTCCTCATCAATATGTAAGGGTGGTTTCACATGCCCCTC
AACTTTTGCCTGCTGTGTTAGGGTGGGACAAGGCTTTGGTTAAAACCAAGGGTTGGAAAG
GCTGGACATAGTGGCTCATGCCTGTAGTCCTAGCACTTTGGGAGGCTGAGGTGGGTGGAT
TGCTTGAGCTCAGGAGTTCAAACCAGCCTGTGTGAAAGTGAGACCCTGTCTCTAATAAAA
ATAGTAAAAACTAGCTGGGCATT
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved