Otolemur_garnettii Locus Mono:469:SNORD58
snOPY snoRNA Orthological Gene Database
Otolemur_garnettii Mono:469:SNORD58
Otolemur_garnettii
Mono:469:SNORD58
GeneScaffold_2185
SNORD58
1001..1056
2056
GGGACGTAGGCAGAAGCAACTGACAAATGTGTAAGTCCATGTCCACCGAGAAGTGGAAA
CCAAGATGAATTTTGAAGAGATCAATGGGAGGTAAACCCAGGGGGCATCAAGGGGAGAAG
GAAAGTACGTAGTAGGGAAGACCTTCAGAGCTGATAGTAAAATAAAGCACAGGAAAGGAG
AGGGGGTGATCGGAGGATTGGGTAGCAACAGCCTCAGACGGGCGTAGAGTTTGGGAAAGA
CTTACCCAGCCCCAAAATTTGCTCTGACACACATAAACGGGGTCTTATATCCTGCCCCAT
ATTAAGTCAGTCATTGATTGGTGGCTGCCTGAGTAGCAAGGGGCCTCGACTCCAGAGCTG
AAGCAGATCCTGAAGGCACCAGCTAGGCAGCCTTGTTTTGCTGCCCTCTCTGTGGCAGAG
TCTCTCTGGAAAGGAGGTGTGGGCTCTTGCCCTCCATGGCTGCCACAGCCAGGCAGCCTG
AAAACACAGGGTCCCGGGCCCGCCCTCTGCAGCACAGAATGGAGCAGCGGGAGGGTGTGG
ACAGAGCTAAGTGCAAACGGGGCGAATGAGCAGAGCACAGGGAAAAACCACCAGTTTGAG
TAAATAGTTCAGTAATTGTGGCATATATAGTTTTATTAGACTTAGATTTGAGAGCACTGA
TTTAGGATTAAAATTAGTTGCTAATTATTTCTAAGAAACCAATTCTTTTCCTAATAGAAC
CAATTTTATGTTTAAGAATATTAAGACCTGAGGGTGCCTGTGGTTCCAAGGAGTAGAGCG
CCAGCCCCATATATGCAGGAGGTGGCAGGATCAAACATGGCCCCGACCAAAAAAAAAAAA
AAGAATATTAAGAACTTACATAAGTAACTTTAAAAAGAAACTTTATTAAGTTTGCACTAC
AAACTTAGTAGAAACTTTGCACGACAGAATGCAAAGTTGGAACAAACCTCACAACTCCTA
ATTCCACCTGCTTCTTTTGTAGATGTTAAAATAGACTCAAGTTGCAGTGATGCCTCTCTT
AGGACACCTTTGGATTTACCGTTAAATTCTGAGCAGCCACCTCTTATTCAGCTATCACAT
ATAAAGAGCTCTTGGACTTAAGTTGTTTTGTTTTTGTTTTTGTTTTTGTTTTTGTTTTTG
CCAGGACTGGGTTTGAACCTGCCACCTCTGGTATATGGGGCCAGTGCTCTAATCCTTTGG
GCCATAGGTGCCGCTCTCTTTGACTTAAGATTTGTGCAATTGAGTAAAACTGCCAGAGCT
GTTTTGAGAACCAAGTGTGCAGGTTAAGATGGGATGCCAAATTGTAATTAGAAGATGATA
GAATTTCAACATTTGGGTGAATAATGACAGAACACACATGAAACGGCCCAGGCCATCAAG
AGTATACATAACAAAAAGCCACCAAGTGTCTGAAGGATGTCATTTTAAAAAAAAATTGTG
TACCCTTCCAGCGTTACAATGGTGGCGTTAGTAGGTGTGCCCAGGCCACACAGTGGGGGT
CAGTGGCCCCAAACATGCCTAATTTTTGCTGCACGTGCTTAAAATGCAGAGAGAATGCTG
ACTTGAGGTTTAGGAGTAGATTCTCTGGTCATTGAGCATATCCAAGCAACAAGCACCGAG
ATGCATCACCTAACTTAAGAGCCCATGTCTCATAACTCATACGTGAGCTCCCNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNAAA
GGGAAAAGAACGCACTGTGACAGTTATCCTAACTGACCTTTTAAAAGGTCATTAAAGAAA
ACTATCCTAAGAATAAATGAACATACCCCACTTAATCAATTTGATAGGTTTAATAGATCC
TTAGTAAAGGATAATATATAAGTTATTAGGTTGAAAAGGGTCAACCTAGGCACAATCTAC
CAATTGATAACAGTTTTTAATTTTTATAACTCATGTTTATACATCTATAAATGTTTTTTA
AGTAGTTTTTGTTTTGT
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved