Otolemur_garnettii Locus Mono:472:SNORD24
snOPY snoRNA Orthological Gene Database
Otolemur_garnettii Mono:472:SNORD24
Otolemur_garnettii
Mono:472:SNORD24
GeneScaffold_3192
SNORD24
1001..1065
2065
ATACTACATCTTACCACTGCAGAATATACCCTGTGTTTAAGAGCATTTACCAAGGTAGG
TCCTAACATACTGTGATTTAAAACAAATCTTAAGAAACTTAAAAGTAGCAAAATTATATA
AAATTTGTTTTCTAGCTGCAATTGAATTTAATTAGAAATCAGTCGTGTTGAGATAGTATT
AAGATAGCTAGGAAATCCTCAAATATCTGGAAATTAGACCATATCTCTAAATAATGAATA
AAGCAAAATCACAAGAGAACTAATGACTTAAAAAAAAAAAAAAACTAAACTAGCTAGGCG
TGGTGGCTCATGCCTATAATCCTAGCTGAGCTCAGGAGTTTGAGACTACCCTGAGCAACA
GTGAGACCCCCATCTATTAAAAAAACAAAACTAAACTAAAAAAACCTACTACATAACTAA
ATTTGTCAGATGTAGCTAACAGGAAATTTTTGTGCTTGTATTAAACAAGAAAAAAAAATC
CAAAATAAAAAACCTGACATTCTACCTCAAAAAGCTATAAACATAACAGCAAAGTAAACA
CAAGGAAGGAAATAACAAAAGCAACAGCAGAAAGACACAGCACAGAAGACAGAGAAACAG
AGAAAATGAACAGAGCCAAAAGTTGGTTCTTTCAAAAGATGCACAAAATAGATAATCCCC
AACTACACTGACTAGGAAAAAGAACTGACAGAAAATGCCAGTCCCTGACATTTATCAACA
CAGAACTTACTGGCACTAAAAGGTAACAAAACAATACTAAAAACAATTTATGCCACCAAT
TTGATAACTTAGTTGAAATGGATGCATTTTTTAAAACTCAGCAAAACTGACACAGAATGA
GCAAATTGAAGAGCCCAGTATTGATTAGAGAAATTGAATTCCTTACCAAAAATTGGCCCC
CCAAGAAAACTGCAGGCCAAGCTGGTTTTACCAATTAATTCTAACAACCATTCAAGGAAG
AAAGCTGGTTACACACAAACTGTATTAGAAAACCCAAGAGTTGCAGATGATGTGAGAGAA
TAGTTGCTATCTGCGCGATGGTGATGGCGTCCGAAACCACCAAGCAAGGAGGTCTGTCTG
GTCCCAGGGCGGCATGATATTGACTTTGTGGAGTTTGACAATGAGGTGCAGGCAGCAGCA
GCTCGTGATGCCCTTCAAGGCTTTAAGATCACCCAGAACAATGCTATGAAGATCTCCTTT
GCCAAGAAGTAGCATCTTGCCCCCATGCCTGCCCCTGCCTCTGTTCTGGGGCCACCCCTT
ATCCCCCTGGCTCAGCCCACTGAAGGTAAGTCCCCCCTTGGGGGCCTTCTTGGAGCCGTG
TGTGAGTGAGAGGTTGCTACACAGCATTGTACCCAGAATCTGTCCCCAGACATTGCACCT
GGTGCTGTTAGGGTGGAATTAAAGTGGTTTTTTTGACGTTTGGTTTTTCACAAAAAAAAA
AAAAAAAAAAGAGGGAGGGAGGGAGGGAAGGAAGGAAGGAAATCCAAGAGTAGTAAGAGC
AGGAAGCACACNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNN
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved