Otolemur_garnettii Locus Mono:28:SNORD113
snOPY snoRNA Orthological Gene Database
Otolemur_garnettii Mono:28:SNORD113
Otolemur_garnettii
Mono:28:SNORD113
scaffold_3292
SNORD113
1001..1063
2063
GTGTCTGTGAAAACTGTGCTTTAAATTATATTTTCATATGTTTTGTTGGGGACAGAGCA
GATAAGCTCGAAAGCAACCGAGTTTGTTTTAGAACTGAAGACAACTTTATCAAAATTTCT
GTCAAGAAAAGCTGCTTATAAATGTAATGAAATCACATTTAAAATAAACTGCCTCTGATC
ACCCCCCCCCCAAAAGATGGATAAACTGTAGGCCATCTTCTTATGCAAAATAATTCAGAA
ACAGAAAGACAAATGCTGCATGTTTTCACTTGCTAATAATGAATGTAGAATGATAGACAT
TGGTGACTTGAAAGTGTGGGACAAGTTGGGGATGGGGTGGGGGATGCAAAATTATTTAAC
TGGTACAATATCCTTTACTGCGGTGATGTATACATTAAAAGTCCTGAATTCACCACAATG
CAACATATCAATGTATCAAAATTACTTTTGTATTTTATAAATTCATATATTATATTAAGA
AAAGAAAGTTCAAAAAAATCAAAAAGGAAAAAGTAAGCTATAGAAAACAGTGAAACTGAG
CTTCTATTATTCAAAACATGTTGGTGTGGCTGGGTGTGGTGGCTCATGCCTGTAATCCTT
GTCCTATAGGCTGAGGCAGGTGGATTGCCTAAGCTCAAGAGTTTGGGACCACCCTAGTAA
GAGCAAAACTCTGTCTGTACAAAAAATAGAAAAAAAAAAACTAGCTAGGCATCATGGTGG
GTGCCTATAGTCCCAGGTACTTGGGAGTCTGAGGCAAAAGGATTTCTTGAACCCAAGACT
ATGAGGTTGCTGTGAGCTATGACTGATGATGCCACAGCACTCTACTCAGGGCAAAAGAGT
AAGATTCTGCTCAAATAAAGAAACGAAACCCAAAACACGCACACACACACACACACACAC
ACACTCTCACATTGGTGTGGTTCTGGTAGAGTTTAATGCTATGTGAGTCAGGCACTAAAG
TACTACTTCTCTTCATCCCAGGTAAATAGTTCATCAAGACCTGAACTTGCAGGCATATGA
GTCTTGGATGATGAATAATATGTGTCTGAAACTCTGAGGTTCAACAAAACAAAACAAACA
AACAAACAAAAAACCTGAACTCACTGTACTTCTGTGGGGTATGAAAACAAATTCTTCTGA
TCCCCATTTAAGTAAACTGCTGCTGTGATTAACAACTAAATTAATATTTATTTTGAGAAT
CAGCAAAAAAGCTGAATAAGATGATCTCGAATCATGGTACACCATGAGTCAATGTTGGTG
AACTCAGTTGAACTCAATGTTTACCTTGCAGGGAAGGGCGCATGACACAGGGGGTAGAGG
TTGCAGCCTCAGATTTATCATCTTCAGACACCAAGTTCTTGGTCAAGGTACTGAGTCTCT
AAGACCCAGTTTACTCATCTCTAAAATGGGTTAATTTTACTTTAGGTATTGAGAGATTCA
AAAGGGATATTTGATAGATGAAAAAATTTTCTGTATATTTTCACAATCACTGTTAACATG
ACTGATAAAACATTATGCAACTAACAATTGTGTCTTGACATAATTTCCTTAATGAAAGAC
TTGGAAATAACAACACTAGTCAATTTAGAATGAATATGATGGCAACTTTACACTCATTAG
TGTATACCATTCTAATTGAATTTAGGTTCTCTTAACCACTGAATATCCGCCCCTAGTCGG
ATCTGAACTTTGTGGTGGTTCTGTGTGGTGGGTCCATTTAATGATTTCCCTCTCTCCCAT
CCTTTACTGAATCCACAGTGGTGTTCTGTCTATAATTGCTCCTCTTTGCTGTGTATTATT
CCATCCTATTATTTCCAACAATGAGAGACCAAAAACACCAGAGAAAGCTGTGTCTAGAGG
TAACTGGGAGGGGAGAAGTCATAGTTTGTAAAGCCCTCCCTACTAAATTCTCTGAGATTG
GCTTTTATGTCAGTTGCACTGAGCAACTTTTATCTTTCCAGGGATAGAGAGTGGGAGAGC
TCTATCTTTTATTTCTTCTCTTGATCATCCTCAGTCCTTTTATCCTTGGAGTCAAATTCC
ACTGAGAAGTGAGTATAAGGTGCA
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved