Otolemur_garnettii Locus Mono:54:SNORA28
snOPY snoRNA Orthological Gene Database
Otolemur_garnettii Mono:54:SNORA28
Otolemur_garnettii
Mono:54:SNORA28
scaffold_97627
SNORA28
1001..1124
2124
TTTCAATCAAAGTGCTTTGTCATTCAAAGTAAAACCAAATCATTAGCAAGGATCTCTGG
AGGAATTGACTACCAACTTATATAGTTCACAGGTATATGTGATCCCTGAGGCAAGTCAGA
ATTTCTCCTGCTTCTGCTGAGAAGAAGTTTTGCAAATGATAACAGACAACTCAGGAAGAT
CTTGACTACCCTGAGTAATAACCTCCAAGCCCCCACAGAATACATTAATTTTCCACCCCA
ACTGCCTCCCTATACACTTCAAGGACAACAGCTGGATTATTACTAACTATGGAATTTCCA
AGTTTGCCAGAATTCTGTTTGTAACCATTATGGGATTAGCAGTAGGAGAGAGGCCTTGAT
CACTAGAATAGCTGAGGCTATCACACAGCTACACTCCTATGTGAAAGAACACACTGATAC
AGGTTAAAAGAAGTCACATTTTACTTCCATGTAGTCCCTAAACAGACAGTTCCTTTTCCC
TTGCTATTCTAGGGAGTCCTGTCCTCTAAATATAAAAAACACTGTATACATAGGCACAGA
CATACTCACATACAGCCTAGCTTGCTTACTTACAGGAACTATCCAGGTAGCTATATTCAG
TCCTGACAGAATCCATTTTGGATTTATAAACAGGCACCTGCCTGGCACATTTCTATCCAC
CTGGATTTCAATCTATTTTTCCAGGAAGAATAAACTACACTAGATTCCTCCCACTGTTAG
CCATGTGATAAAGATAGCCATGTCTGCTGAAGTCTGTTTACATAGGCCAAAATAAGATAT
GACAATGACACAGCACTTACATTTCTGATACAACTATCCTTAACAGTGATCTCAATTTTA
AAGAATGAATCTTAAAAATATTCTTAATAATAATGGGCTATGCTTGTAGCTCAGTGGGTA
AAGCACTGGCCACATACACTGAGGCTGGAGGGTTCAAACCCGGCCCAGGCCAGCTAAAAC
AACAACAACTGCAACAACAACAACAAAAATAATCTGAGCATTATGACGGGTGCCACAAAA
TATAAATATATACTGACACAATTTGAGCCTTGCTATAGCAAGAAAGTCTAACCTATTCCG
GTGTTCTCTCTTTGTGGGATAAGCCGTTATATAGACTTTAACAGTGGAAAAATTTTTTTA
ATTGAGACAGTCTTACTATGTCCCCTTTGGTAGAGTGCTGTAGTGTCAGAGCTCACAGTA
ACCGCAAAACTCTTGGGCTTAAGCGATTCTGTTGCCTCAGCCTCCCGAGTAGCTAGGACT
ATAGGCACCTGCCACAAGGCCTGGCTATTTTTTGTTGCAATTGTCATTGTTGTTTGGCAG
GCCTGGGATGGATTCGAACGCGCCAGCTCCAGTGTATGTGCTGGCGCCCTAGCCACTGAA
CTACACACACTGAGCCATTATTTTTCTTTTTCTTTTTAGACAGAGTCTCACTCCACGCCC
TGAGTTGAGTGCCATGGGATCATAGCTCCCAGCAAGTAGCTGGGACTACAGGTCCTTGCC
ACTATACCTAGCTAGTTTACCTATTTTTAGTAGAGACAGGATCTCATCCTTGCTCAGGCT
AGTCTCAAACTCCTAAGTTTAAGCAATATGCCCGCTCCAGCCTCCCAGAGGGCTAGAATT
ACATGTGTGAGCCAATTCAAAAATTATTTTTATTCACTTATGGTATCTAAATGCTTTTTT
AAGGACACCAATTCAAGCCAATGGTGACTCATGCCTATAATCCTAGTATTCTGGGAGGCT
AAGGTAAGAGGATCCCTGAACCCAGGAGTTTGAGACTGTCGTGAGTTAGGCTGATGCCCC
GGCACTCTAGCCTGGGCAACAGAATGAGATTCTGTCTAAAAAAAAAAAAAAAAAAAAGGA
AGAACAAGTCTTGAAGTCGAAGTCTACATCAATTACCTATCATCTTTTCTGTGATTCTCT
TTTAGAATCTGATCTCCTGGGCAACACCTGTGGCTCAGTGAGTAGGGCGCGGGCCCCATA
CACTCAGGCTGGCAGGTTCGAACCCAGCCTGAGCCAGCTAAAACAACAATGACACCTGCA
ACAGAAAAATAGCCAGGCATTGTGGCAAGCACCTGTAATCCCAGCTACTCAGGAAGCTGA
GGCAAGAGAACTGCCTAAGCCCAAG
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved