Otolemur_garnettii Locus Mono:134:SNORA62
snOPY snoRNA Orthological Gene Database
Otolemur_garnettii Mono:134:SNORA62
Otolemur_garnettii
Mono:134:SNORA62
scaffold_110863
SNORA62
1001..1154
2154
TTCTTGTCATCTAAGTGGTGGAATTCATTGACATAAAGTTTTTCATAATGTTTACTTAT
TATTATCCTTTTGATGTTTGTAGAATCTGTAATTATAACTCTTATTTCATTCCTGATATT
GGTTATTTATGTTCTTTGTGGCTTTGGAAACCAAATGTTGAAAATATTGAAGCCACAAGA
TCAGAAACACCTGCCTCATATTGTTACATGCGCAAGAAATAAACATCTGTTATATTAAGT
CACTGTGATTTGGGGGATTTTCATTGTTGTAGCAACCAGCATAACCTTCCCTAATGCAGA
TTGTCATTACTGGTTTATATTGCTCATTATACTGGGGGCTTCTGGAGGACAGGGGCCATG
ACAATACTGCTCTTGGTGTTTGTTTCAATGCTCAGCACACTACTTGTTGCATATTAGACT
TTCAATAAATGTTTCTTGACTATAAATAAATCACTGAAATTGTTCCTTATGTATTTGGAG
TCTAGAAGTCTTCTCTCCCTGAGATAAATGACTCAGCTCCAACCACATTGCTTTTTTTTT
TCCTCACTTTCTTTCCCCCATTTTCTTCTCCCTTCTCACTGCTTTTTTTTGTCTTGCGTT
ATAAGAAAAATACTATAGATAACTCTGAGACCTTTCCAAATATCCATCTCCTCAATTGTG
AGCCTGCTGCAAGGGAATTGAGAATAATACAGACATGGGATGGGCTTATGTTTGCTTTTG
CTTTCTTACCCAAACAAACAAACAAACCCAACCAAATGAAGCGCAATAACTCTCAGAACT
CTATGCAAATGACTAAGTAAAAATGGATCCCAGGGAGGAGCATTGAGATTACTTGGAAGA
ATGAGCTTTTAAAGGATTCTTCCAGTGGTGTCAGTTGAGTCCCTTTGCATATAAACAATA
GACCAATTGCAAATTGTATCGAGTTCAAGTAGGTATAAGGTTCATATTTTGCTACATCTA
AGCATATATTCCTATAAAATAGTTTCATCAAAAATATTTTTTGTGTACGTTGTTAGAGCT
TGGAGTTGAGGCCACTGACTGGCCGATGAACTCACAAGGGTAGATTGTGAGCTATGTGAG
TGGCAAATTTTTCGCTAACATCACAAGGGTATCTGGCCCAATGAGTGGAGTTTGATAATA
CTCCTTGCTACAAGTATAATGGTAAAAACTCTTTGTTGAGTTAGATTTTGACTGAGTTGG
ATTAGTCATCTTAAATAAGACAACATTGGTGAGGGCTCAATGTGTTAAGTGGGATGTTAA
CAAATCCCACTTCCACTTATTGGGGCCAGGACTGGCCAGGCCTCCAGCTCCCCCCACCAC
TCCGCTTATCTGTGTTCCTGACACTGCCCACTTTGCTATCTAGCTCAGGAGCAATTGATC
TTAGGTGCCTGAGGGTTATTCGCTTTAGCAGAAGGGAGAGAAAGAGAAAGATACAGTTTT
TGAGGGAGAAGAAGTATATTTGACTTAATAAAATTAAAAAAAAAAAAAGAATAGATCTTA
GCAGTCTTTAGCAGAGCTTAACAATCTTTTTAGCAGAGAGATGCTGTACTGGCGTTCTGC
AAGTAGGAGAAGTGACAGACAGAGTCAGAGTAAGCGGGTCTGTGACAAAATGAGCTCACT
CCCAAGGGCCTTCTCCTCCAGCCTCTTATGAAGCTGAGTTCATGGCTCTTATGCCACATA
TGTAGCAATTGCTGCTGCTCTCATCTCGCGAGCTCTCTCATGCTTGTTAGGAGAGCTAAC
TCCCTCCCCATGCCCTTTTGACCAAGGTGTTCCATTATCAAGCTATACAGGTGTTACTTA
TAACTCTCACTCCTCCTTGCCATATGCTATAGGTGCTGCTACAACAAACGTGGGTACAAA
GTATGCAGTTTGGACTCATCTCTTGCCACCATCACTTCTTTACCATGACCTTGAAAATAG
GACCAACCTATAGCCTCTAAAATACTGTGAAAGACACATGGAAAAGACTCAGGTCCTCTG
AAGCCTTCTAAGACCAGTCAACCTCCAGTCCACATGCCAGCTGACCTCAGGCACACAGGT
AAGCCAAGGTAGGGTCAATCCAGCATAACCCAGACCAGCAGACTGCTCAACTGACCCACA
GACCAGTGAGAAATATTAGAATATTGTTTTTAAGTCATTTTGCTTTGGGATACCT
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved