Otolemur_garnettii Locus Mono:92:SNORA44
snOPY snoRNA Orthological Gene Database
Otolemur_garnettii Mono:92:SNORA44
Otolemur_garnettii
Mono:92:SNORA44
scaffold_103750
SNORA44
1001..1124
2124
GGGTTTTTTGTTTGTTTGTTTTTTTACTGTTTGGGACTCATTGAGGGTACCAAGAATTA
GGTTATACTGATTGCATTTGTTAAGTAAAGTCCCTCTTATAATTGTGTCCCACCCCCAAA
AGAAGTGTGTCACACATTTTGACCCCCCATCCTCCTCCCTCCTCCCCTCTGCCTGCTCCC
TCATTTCTCAATCCCCTACCTTGTATGTATTTTTATTTGTTTCAAATTACTATGAGGACA
CAAATGTTTGGATTACATTGTTTTTAATTCTATGGTAAGGTGCAAGTTGTAGGGAGCCCT
TCACCCAGCGGCAGTGCTGAACACCCTCACACTGTACTCCTTAAGTGAGATCCTGACAAT
TGCTCTCCCCATCACCCTGCCTCCTTTTCTCTCCCCCTTACTAGACTGTGTTTGTATTTT
TTCTTTTGTGTAGTCATGTAGTTGTTTTTGTTTTGTTTTGTTTTTTCCATTTTGGGGCTA
CTTTACTAAGAAGAATGTGTTTCAGCTCCATCCAGGTAAACATAAAAGCTGTAAAGTCCC
CAACTCTTCTTACAGGTGATAGTACTCCGTGGTATACATGTGCCACAGTTTGTTAATCCG
TCCATGGGTTGGTGGGCATTTGGGATGCTTCCGTGACTTGGCAATTGTGAAGTGAGCTGC
AGTCAACGTTCTGGTGGAAGTATCTTTGTGGCAAATTGTTTACATGCATGGAAGAAATTA
GTAACCAAATTATTAATTGACTTATTTAATTATAGATTATCTTATGGGAGCTTTGGGAGC
TGGTGGTGCTGAAGCCAGGGCCGCGTCTGTCTTCAGTGGTAACAGTGACTGGGAGGAGGC
CGCAGGTGTGTTCTGAGGTGCTGGTCAAGTTCTCTCTTTTTACCTTCAAAGTGCATGCAA
GTGGATGTTCACTTTTTAAAATATGTATCAAACCATACACTTGTCGTTTGTTCAGTTTTC
TACGTGTATGTTATAGCAGTTTATTCACAATATCACTTCAAAAGTATGTTTCCAAGGGCT
GGTTGTGGCCATGAGATCTCCAACTGCAAGAGCAATCTGGAGAGACCGGGACAGACAGCG
TAAGGCCGCACTATAGCTGCAGCCGCCACCGCCTTTCCTGTAAGATTTGGGGATCTGGGC
TGGAAATTTTCCACTCAGGGCCATGTCGATGAACATATTCGGATCAGCTTCTTGTTTTGG
AGCTTTCATGCTAAGCTTCTGTTCGGCAGGTGGCCCCAAAGTCTCCTGGAGTGTTTGCTA
CCAAAGAATTTGAAGACATTGGCCTGTTTCTCAAGCTGTGCTTTCCACTAAGATCTATGT
GACTCGCTTTCTTCACCTCTGGCTACAGAGTTGGAAGACGAACGTGGTGGCAGAGGCAGG
AAGAGAGACAGGAGGTGATTTTCGGTGGAAACACCAAGTTCTGTGAGCACAGTCCTTTGT
CTCTGCAGTGCTATAGTGGATGCCTGAACTACAGAAGAACAAGAACGAAATCTCTGAAAG
TGAAGGAAAAAGCCACTTCAAACTTACAGGAGAAGATTTCTTAAGGACGCTTGTAAAGCC
CTAACTTAACATTTCTTGAATTCGACAGACACTGTTTGTTTAGGGTATTGCAGCCAAATT
CACTTTGACACGATGGACAAAGAGAAGTCGTGCGCCAACGGCGTTTCCGTTCTCACCTTC
CCGGGGAAATATGGACCTCAATCGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNN
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved