Otolemur_garnettii Locus Mono:157:SNORD43
snOPY snoRNA Orthological Gene Database
Otolemur_garnettii Mono:157:SNORD43
Otolemur_garnettii
Mono:157:SNORD43
scaffold_117785
SNORD43
1001..1061
2061
AACACCTGGTGGCTCCAGTTTACCTTGACAGTCGTCTTATGCAGGCAGGGGACAGTGCA
GAGCAGGCAGGAGGTGACTGAGAGTAGCAAGGTCTAGGCAACTGTGTCCATACTATTCAG
CCATAAAAACAGGGAGGCTTTATATAGTTTGTATTTACCTAGATGGATCTGAAGCACATT
CCTCTTAGTAAAGTATAACAAGAATGGAAAAGGAAGTATCCCATGTACTCAATACTAATG
TGAAACCAATAGTAAAACAACTACCCACCCACAGGAGATAAAAACATGATTGTATTCAAG
TGAGGTGAAGAGGGGGGTGTAGGGCACTGGACTGGTGAGTTCTCACCTAATAGACACCAT
GTAAGGGTATGCAGCACACTCCCTGGATGGGGAGCTCACTACAACTTAGCTTTACCTTAG
AAACACAAACAATGTAACCTGATCGTTTGTACCCTCATATTAATCTAAAATTAATAAAAA
GAGAAAAAAAATAAAATGTTTTTCAAGTTGCTGAAAAAAAGAAGGTTGAGTCATAGAAAC
ACATGGAAATCTCTACCACACAAACAGACATTGTAAAATAGTTTTAATCTACTTCTTTTA
TTCATAAAAGAGTATTTGTGAAGATGTTTCCTAAACAATGAATATATGGGCAATATATTT
GTAAAAAGTTCACAATTATCTTATGTTGTCAACCATCTGAACATCGAAATTGCAAAATTT
AAAACACTCAGAAATAAAAAATTCATAAAATAAAATAATTTTCTATCTCCCCCAAACACA
CACACTGATTTGTCAACTAAATCTTTTTAATGTGCTATTTTTCCACAGCAGTATATGAAC
ATGATCCTTAGTCAATAAATGTATTTCTACAGGATCATTTTGTGACTAAGGCCACAGATT
TTCTTGATTTACAAGTTATCTCACTCACTATGTCACGTTACTAGTTTAATCTTTTCATTT
TCTAAGATGTATCAAACATAACCAAGATGTATATTAGAAATTCAAACAGATGAACTCATT
GATGGGCAGACAGAGACTGTGCTGATTGTCATGTTCTGTTGTGGTTCTGTGGAATTCCGC
TGGCCTGCATGTATCAGTCTATACCCATTACCTACTGCTGGACCATTTGTTCCCTAGTTG
TTGGGGGTCAGACTCTAGATGATTTGCCTATAAACCAAATTGTTATCTTAAAACTGACTT
AAGTGTGTTTTTGTCTGCTATGAGAGAAAAACAGTGAACATTGTTCCTAAAAATTTAGAC
AAGTTGGAGTAAACCTTCAATGCTCATTTTGTTGAATGTTAGTGTATTCTGGATTTGCGG
ATTCCTGGGAAAAGGTGAACTTAGCATATAATCACATTAACCTGGTTTTAGGCCCAGTCA
AAAGTCAGCATTGCTGAGAATGCTTAGAACAGCGGTTCTCAACCTGTGGGTCATGACCAG
TGAAAATACATACTGTATGTCAGATATTTACATTAAAATTCATAACAGTAGCAAAGTTAT
AGTTGTGAAGTAGCAACAAAAGTAATTTTATGGCTGGGGGTCACCACAACATGAGGAAGT
GTATCAAAGGGTCGTGGCATTAGGAAGGTTGAGAACCACTGGCTTAGAACCTAAGCAGCT
GAGAACTAAACTGGAGGCTGTTTTGTTTTGGGTGTTAATATTGGCATGTTTTTCAAAAAT
AAAAATAAGAATAAAAAAATAGAAATTCAAAATCTTCTGCCTCTCGAAATGTCCCCCATT
TTCTCTTTCTCTATTACGTAAGAATAGTCTCGTTTAATTTCTTAAGATATTCTCCAGATA
TTTTTTCTTCATGTGATACCCTAACTTATTTTAGTAACACACATACCTGTAAATCAATGT
TGAGGTTTGTATAATATATATATATGTATCTATACATATATACATATTCCTCTACATAAT
GGAATCATATACATTGTCATTTATGACTTTCCTGACTGAGTATATATCATGGCTTTTAAT
CTAATTTTTCATTTGTTTTGTATTTTTTCTAATGTTTTGGGGGAATTTATATTGCTTTTT
CGGTGTATTATGCGGCGCCCTA
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved