Otolemur_garnettii Locus Mono:339:SNORD101
snOPY snoRNA Orthological Gene Database
Otolemur_garnettii Mono:339:SNORD101
Otolemur_garnettii
Mono:339:SNORD101
GeneScaffold_87
SNORD101
1001..1073
2073
GGGAGAGGACTTAGAAGGAAAAGCTGGGGGACGCTGAAGCCAAGAGAGAGACCAGCCTG
AGGGCAGGGAAGAGGGACAGGTCTATGGATGGAAAAGAGACAGAAAACCTGGTGAAGCCC
AAACTCCTGAGGCAGGACCACTGAAAGGCTGAGACTTAACTGGAAAATTAGACAATGCCC
TCCCCGCCCCCAACCTGCACCATGCTGATAGTAACAGCAATAATAGCTCGGAACTGAGAC
GGGAGGGCACAGCAGAGCTAAAGGAAAGCGCTAACGGAGGCTCTAATGGCTCTACTGGAA
GAATAGATAAAGAATACGCATGAATAGATGGGTAGCACAAACATAGACGTGGCCTTCTAA
GTCTCAGAAGGAACTTCAGAGATGTGGCCTTCTAAGTTCCTCAGAAGGAACTACCAGAAA
CCAAATCACAGTGACAGGAACAGAGACTGTCCTTGGTGGGATCATCAGAGCACTAGAAAC
CGCGGAGGAAAGAGTCTCTGAGCTTGGAGAGTGATGAATAGAAATTCTTAAACTGAAGTG
AAAAGAGAAAAAAGGAATGGAAAAAGACATTCTTTGTGCACCTACTAAACATTATTATAA
AAGGGACACTTATAAAGAATGAAATACGTGGATCGTTATGAAAGTTTTCAGAGACACAAA
ATCAGAAACATAAAGTTTGCACAGACAGAAACAATGAAACCCTTCTAGCAATACCTTTAA
GCAGAGCAAGTTGAAAACTGCGTGGTAAATCAGAAAGGCCACTGTCGACTGTGTTCCTGG
AAGTGAAATAACGGAGCATAACACAGTCTGTCTCACAGCCAGGGTCAGGGAGAGGGAGGA
AGACGTAACCTGTAAGGGACCTAGGATTAGAGTCACAGTGGACATCTCAGAAACTATGCA
AGCAGAAAGAGAGTGGAGTGAAATCTTTTGTGTCGAAAGAAAAAATTATCAACCACAAAT
TTTATGCCCAGTGAAAATGTCTTTCAAAAATGAACCAGAAATTTTGAATGATGACTTCAG
TTGTGGGATACCCCTTCACTCTTTTTGTGAGTGAAACATAACAGTCTGACAAATCTGTAA
TAGTAATAAAAGAAAAAATGAATCAGAAATAAAGTCTTTCTCAGACAGACAAAAACTGAA
AGAATTTATCGCCAACAAATCTACCCTGGAAGGTTAAAAGAAAGTCTTTAGGAAGAAGGA
AAATGATATAGGTCAAAAACTCAGATCTACATAAAGAAAGAAAAAATATCAGAAAGGAAT
AAATGAAAGATAATTTTTTTTTACTTCAACCAGTCCAAAAGAGAACTGTTTAAAGCAATA
ATGATGCCTGTAGTCCCAGCTACTCGGGAGGCTAAGGCAAGAGAATTGCCTAAGCCCAGG
AGTCAGAGGTTGCTGTGAGCTGTGTGGTGCCACCGCACTCTTACCAAGGGTGACAACATG
AGGAGAGGGGAGAGGAGGGGGGAGGGTGGGGGGAGGAGGGTGATTGGCGGGATCACGCCT
ATGGTTCATCCTATAAGGGTACATGTGAATCTCTCTAAATGTAGAATNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved