Otolemur_garnettii Locus Mono:405:SNORD65
snOPY snoRNA Orthological Gene Database
Otolemur_garnettii Mono:405:SNORD65
Otolemur_garnettii
Mono:405:SNORD65
GeneScaffold_4129
SNORD65
1001..1073
2073
GACAGCGTAATTATAAGGTAGGAGCTCAGTCTGGGCAGGGTTTAATATGTAACTTATCT
TAAATGCACTGAAAGCGATGTTTTTACAGTTGTTACACGTGTCCCCATTGCATGGTGTGA
AGCAGCAGCGGAACTGCGTCTAAACCAAAGTTATACGTGAATATGGAAACAGCTTCCTTA
AAAAACGTCGCCAGTGGCTGTTTTTAGTGGTTTCAGACAATGGTGGTCTCTGGTTGTAGA
AGTACTGGGGAATGGTGAGGCGTTTTGACTGCTCTGATGAAATCGCTAATAGGAAGTGCC
GTCAGAAGCGATAACTGACGATAACTATTACTGTCTGACTGCAGTCAACAAGTCCTCACC
AGTTGCTACTTCCCAGGAATGAATTTGTCTGAACTGTGGCTTAATTGCTATATTCATCCA
GGTTGCAAATAAGGGAAGGATTACCAGCATGTTCGGATGCTGAGTACTGGATCCAGGAGC
ATTGGCCTTCATGAGGTACGTTTTATTCTATGCTGAGATAGTGTTTATCCCATCCTTGAA
ACAAAAGTAGTCATAGATTTGTGAAATTTAAAATGATATGACTAAATAGAGGTTACGACT
TTAATAGAAACTAATTAGTACTTGGATACTTAAGTAATTTACCAAAATGGATCTTTAAAA
AAAGCCTCCAAAAAAAAATGCAATCGGTGTAACCTGGTTTCTTGTATCCTCAATGAATAT
TCCGCCCCCCCCCCCCCCCCCAAAAAAAATTGGGAAGAAGGAATTATATTTTGTAGGTTT
GGAATGAGGCTTCTAAGAAAGTCTCCTGCCCGCCACTGCAGGTTTGATTTGGGGGGGCTT
CTCCCTTTCCAGGTTTTGAGAAACGAGTGCTTCAGGGCTAAAATGAGAGCTGGCTAGCCA
TAGCAGCTCAGCCCCAGAAAAAGAGGAAAGCCTTGATCTGATCCCCACAGTAGCATGAAT
AAACAGCTGATTTTGTTAATTGATTTTAAGAAAAGGATATCAAATGATGAAATCACCCCA
AATAGCTGGAATTACCGGCAGATTGTGTAGTGGTGAGCCTATGGTTTTCTGACGATATCT
TTTCTTGTGCAAATGGCTGTTGGTTAGAGCAGGAAGTGAAATTGAAATTCAGTTTCTTTG
CAGGCTGCATCTCCAGAGGATGGATGTCAGTCTGTGAAGGACCAAGAGCTGCTATCAACT
TGGATTCTGAAAACCTAACTGTTGAACATTTGGTGTAGAAGTATGCTTTGTGTATCAGGA
CATTCTCAACAAAGCTAAGAGATGTATTGAGCAACATTTTTCTGTAACTGGCACATTTGG
TATCATTCATTAAATTTCTAGCAATGTCCCTTGCCAGCCTGTCCAACAGGAGCTTCTTAT
ACTAATTGGTTGTTATGTTGGGAGCTAGTTATTTAAAATGGTAATTGTTAATTCCCCTCG
AGTAATGTTTTCATTAAGTTCCCGTGAACTAATACTGTAATAAAGGATGGTCTTTGGTAT
TGGTTGTTACAAATGTATATTTGAAGAAAAAGTAAATTTGACTACTGCTGTCAGGTATTT
GCAGTCCAGCTATAAGCACTCAAGCTTGTAAACTTCCCTAAGTTTTTTTGCTCTTAACAG
TTTTAAACCTCAGAGGGCAAAAATTCCAAAGCATTTAAGGCATAGACACAAATGGTTCTA
ATTCCTGCTGCCTCTTGAGTTCTGTCTCTTTGCATAGCTCTGTTTGATCTCCTTCAGCAT
TTAAATTTCTTGTAGCCAAAATCCTTAACAGTATGCAAGGCCCCATCTTGCTGCCTGCCT
GGTCTGAGGCCCATCAGGCAGTGCTTCCTTGCACTGTTTAATGACTGGTTCCCACAAGAG
ACCTGGGACTAGGGGTTACCTGATTTTTTCTAGGTGGGATTCTTTCACTTTAAGTGTTTT
GAGTAAGGGGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved