Otolemur_garnettii Locus Mono:30:SNORD51
snOPY snoRNA Orthological Gene Database
Otolemur_garnettii Mono:30:SNORD51
Otolemur_garnettii
Mono:30:SNORD51
scaffold_91175
SNORD51
1001..1070
2070
AGAGTCAGGCAGATTTATGAATGGGAAGGTTTTTCTGGCCCTAAGAGTAGCAAGGACAA
GGGTTCTGAGGCAGAAATGTATAGAGGGTATTAGAAGAATGCAAGGAGGGCAGTGTGTCT
GGAGAGCCATGATGGAGAGTGAAGACAAAGCCAGAGAAGTTTCCAAGACTGGGCTGTGAG
GGCACCTGTGGGTCACAGGACAGAAGTTTGTTCTGGATGAGCTAGAAAGCAAATGGAGTG
CTTTGAGCAGAAGGTTTACATGATTTAACTTTAGCTTCAGTAGATTCTCTTAGGCTACTC
TGGAGATCATATGTGAGTGTGTGTATGTGTGTGTGTGGTGGGATATAGGGGTTGCAAGGG
TCCTCAAACTTTTTAAACAGGGGGCCAGTTCACTGTCCCTCAGAGTGTTGGAGGGCCAGA
CTGAAGGCCCCAGGATGAGTTGGCTGCTAAGCAGGACAGGCAGCAGTGGCAAAAACACTC
GGCAGGCCGATAAATGTCCTAGGCGGGCCGCATGTGGCCCATGGGCCGTAGTTTGAGGAC
GCCTGAGAGAAACTGGTGGAAGAATTTTGCAAAATCCCACCAGGATATGATGATAGTGGG
AACAGTAGAGTTGGATATATTTCTATGGTAGAGCCAATATAACTGAAAAATAAAGAGAGA
AGTCAAGGATGACTTTGTATTTTTTGACCTGAGCAACTAGAAGAATGACTTCCTTAAAAT
GGAAGATTTCAGGTAAAGAGCAATTGAGGGGGGACATGGATCAAGGAGCTGGTTTTGAGT
AGGTTGTATCTGAAATGTCCCTTAGGCATCTGTATAGAAATGTCAAGAATGAAGTTAGAT
AGATGAGTATGGAACTCATGGGTGAGATCTCAGCCAATGATATGTATTTAGGAATTTTCA
GTAAATAGGTGTTTGATAAAGTCATGAGAGTGGACAAAATTTCCCAGATGGCAAATCTAG
AAATTGAAAAGGAGAAACTGAGGATAGAGTCTGGAGCGTTCCAGTATATATGGTTCAGAA
GAGGTTTTTTAGCTGAGCTCATGATGGATTTGCTTTTTTCTGATAAAGCTGGTTTAAAAA
CCAAAAAAGAGGAATATCAAGCAAAGGAGGCTGCAGAGAAGCAGCCAGCAAGGGGGAAGG
AAAGGTATTGGAGGAGGGTTTCAAAAAATAGCCCTGATCTATGCACAGGTGCAGCAAAGC
AAGGACTGAGAAGTAATTATTGGCTTCATCTAGCATTTATTAGTATCATGCAAACAGGAG
TTTGAGTACAGTAGAGGAAACAAAGATTAATTAGAGCATGTTCAAGAGTAACATAAACAA
GGGGAAGTGTTGATAAATACACAGGCCAGCCTTCTGGAATTTTGAAGTAAAGGCAGTGAA
GGATGAAGTTCAGGGTTAGCTAAGAAGGATTTTTTTGGTTGTTTTTCAGGTTAGAGATTT
AAGGACACACATGTGTTAATGGAGAAGATCTGCCAGAGCAGGTGCGGCTGATAAGGCTGG
GGTGAGAGGGAACGGAGTGAGTCAGTGCCCAGAGTTGGCTCTGGATAGGAAAAAAGGCGA
CGTGTGGGGTACAGATGCACATAGTTGGTCGGTTTGGTGGTGGGAATGTGGGGACCTCTC
TCTGATTAGTCATCTGGTTTCAATGAAATAAAAGCAGTAAGCCAAGAGTGAGGAAGGGAG
GATGAGGCATTAAATGCCAGAAACTTTATTTTTTGATTGACTGCGTTTCTCTGTTTTCCT
CAGCTAAGTATAAGGAATTTGGAGCAGGGGCCTTTTTCTATCATCTTCTTTAAGCAGAAG
ATATTTACAACTAAGGACATCTTTTACTTTATTTTTGGAAAAAGATTGACCATGAACATC
AGCCAGCCTTCCTGTTACTTAACCTGCCACTCTGCTATTCCAAGTACCAGGTCTGCCCCG
TCACATTACTACCAGGTAGACAATCTGAGACCCATCCTGACCTTCTCTACCCAGATCGAC
ACATGAGATTATGAGTAAAACTGTGCTCTAAAAGTTGCACTGGCCCTTCTCACCCCTTTC
TTGTTCCCAAAGGAATATCTAATCCCCAAAC
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved